Title vs%d}]v
要求简练,精确 C7=N`s}
Compassionate use of bevacizumab (Avastin) in children and young adults with X-y3CO:&@h
refractory or recurrent solid tumors. HJ+Q7)
Bevacizumab-induced transient remodeling of the vasculature in neuroblastoma vI20G89E
xenografts results in improved delivery and efficacy of systemically administered P}=U
#AV4
chemotherapy. :ggXVwpe
Proteomics Approaches to the Systems Biology of Cardiovascular Diseases <%N*IE"q
Pre- and post-natal treatment of hemophagocytic lymphohistiocytosis. h7kn
>q;
Lack of early bevacizumab-related skeletal radiographic changes in children with HV=P!v6
neuroblastoma. SajasjE!^1
Interleukin-4 activates androgen receptor through CBP/p300 ]NyN@9u@(
Trisomy 8 in an allogeneic stem cell transplant recipient representative of a iyv5\
donor-derived constitutional abnormality. 9T_fq56Oh6
Disruption of diacylglycerol metabolism impairs the induction of T cell anergy "BZL*hHq
T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase- :{s0tw>Z
High-dose conformal RT improves tumor control in patients with prostate cancer j;J`PH
Vitamin D concentration does not affect the risk of prostate cancer Jb6)U]
Liver resection with salvage transplantation for hepatocellular carcinoma (tCBbPW6T?
The impact of histopathologic diagnosis on the proper management of testis neoplasms *Ksk1T+>
Prostate stem cell antigen is associated with diffuse-type gastric cancer jbe_r<{
Multiple myeloma: high-risk immunophenotypes identified +45.fo
Increased c-kit expression predicts poor outcome in acute myeloid leukemia
73l,PJ
Global Analysis of the Meiotic Crossover Landscape +E']&v$
Serum Response Factor Is Required for Sprouting Angiogenesis and Vascular Integrity wpD}#LRfm
Integrin Trafficking Regulated by Rab21 Is Necessary for Cytokinesis Pa'N)s<
Reduced Translocation of Nascent Prion Protein During ER Stress Contributes to x~ID[
Neurodegeneration tB`IBuy9!"
Effects of oral niacin on endothelial dysfunction in patients with coronary artery disease: K7t_Q8
Results of the randomized, double-blind, placebo-controlled INEF study. =@D H hg
Global experiences with vardenafil in men with erectile dysfunction and underlying 6OR) 97
conditions. a-lF}P\
2 p
}e| E!
Noninvasive cardiac imaging: implications for risk assessment in adolescents and young QT=i>X
adults. ^iWJqpLe
Transforming growth factor beta1 T29C gene polymorphism and hypertension: yQ!keGj
Relationship with cardiovascular and renal damage. +R_s(2vz
A comparison of hormone therapies on the urinary excretion of prostacyclin and %'/^[j#
thromboxane A2. U#%+FLX@w
Repair of an infected aortic aneurysm using an aortic allograft and a venous autograft: b#*"eZj
Report of a case. OVE?;x>n/1
Circulating Leptin and Stress-induced Cardiovascular Activity in Humans. %pLqX61t=
Effects of aspirin dose on ischaemic events and bleeding after percutaneous coronary *;l[|
intervention: insights from the PCI-CURE study. k\RS L
Long-term cardiovascular outcomes following ischemic heart disease in patients with and BY':R-~(
without peripheral vascular disease. >
vXS6`;
Reduced renal function and sleep-disordered breathing in community-dwelling elderly Z*IW*f&0>1
men.
e'p"
gX
Intracoronary pharmacotherapy in the management of coronary microvascular LYiIJAZ.
dysfunction. 03_M+lv
Inhibition of platelet aggregation by combined therapy with aspirin and cilostazol after _UY=y^ c0>
off-pump coronary artery bypass surgery. `~\8fN
Inhibition of CCR2 Ameliorates Insulin Resistance and Hepatic Steatosis in db/db Mice _:FD#5BZ1
Abstract 要求简洁,连贯 w_DaldK*
The acquisition of metastatic ability by tumor cells is considered a late event in the L* ScSxw
evolution of malignant tumors. We report that untransformed mouse mammary cells that IJC]Al,df
have been engineered to express the inducible oncogenic transgenes MYC and KrasD12, or 9i
D&y)$"
polyoma middle T, and introduced into the systemic circulation of a mouse can bypass ..w$p-1
transformation at the primary site and develop into metastatic pulmonary lesions upon D={$l'y9p
immediate or delayed oncogene induction. Therefore, previously untransformed h,6> ^A
mammary cells may establish residence in the lung once they have entered the z2Z}
mktP
bloodstream and may assume malignant growth upon oncogene activation. Mammary h)aLq
cells lacking oncogenic transgenes displayed a similar capacity for long-term residence in =dmxE*C
the lungs but did not form ectopic tumors. y'n<oSB}
Almost two decades after CFTR was identified as the gene responsible for cystic fibrosis 16Jjf|]j
(CF), we still lack answers to many questions about the pathogenesis of the disease, and it a54S,}|
remains incurable. Mice with a disrupted CFTR gene have greatly facilitated CF studies, w2jB6NQX
but the mutant mice do not develop the characteristic manifestations of human CF, eR/X9<
including abnormalities of the pancreas, lung, intestine, liver, and other organs. Because )\kNufP
pigs share many anatomical and physiological features with humans, we generated pigs B*P;*re
with a targeted disruption of both CFTR alleles. Newborn pigs lacking CFTR exhibited &Aym@G|k?
defective chloride transport and developed meconium ileus, exocrine pancreatic nFe
destruction, and focal biliary cirrhosis, replicating abnormalities seen in newborn humans 8#9OSupp
3 _Y$v=!fY&
with CF. The pig model may provide opportunities to address persistent questions about %eGD1.R
CF pathogenesis and accelerate discovery of strategies for prevention and treatment. ca,c+5
Variable lymphocyte receptors (VLRs) rather than antibodies play the primary role in O2fFh_\
recognition of antigens in the adaptive immune system of jawless vertebrates. Y&y<WN}Q
Combinatorial assembly of leucine-rich repeat (LRR) gene segments achieves the f#hmMa
required repertoire for antigen recognition. We have determined a crystal structure for a FI)0.p
VLR-antigen complex, VLR RBC36 in complex with the H-antigen trisaccharide from {7q8@`Oa
human blood type O erythrocytes, at 1.67 angstrom resolution. RBC36 binds the Q5IN1
^=HF
H-trisaccharide on the concave surface of the LRR modules of the solenoid structure zy~*~;6tW
where three key hydrophilic residues, multiple van der Waals interactions, and the highly @V+KL>Qw
variable insert of the carboxyl-terminal LRR module determine antigen recognition and 6;Mv)|FJF
specificity. The concave surface assembled from the most highly variable regions of the rP/W,!
7:K
LRRs, along with diversity in the sequence and length of the highly variable insert, can q!q=axfMD
account for the recognition of diverse antigens by VLRs. pBn;:
A 51-year-old man with a diagnosis of myelodysplasia and non-Hodgkin's lymphoma #vViEBVeN
underwent an unmatched allogenic bone marrow transplantation and was treated ?}jjBJ&
posttransplant with chronic immunosuppressive medication. Eight months following FY]Et=p
transplantation, he presented with progressive dysarthria, cognitive and visual decline.
?3i<^@?
Evaluation included brain magnetic resonance (MR) imaging demonstrating multifocal |Z$)t%'
areas of increased T2 and FLAIR (fluid attenuated inversion recovery) signals involving w"A>mEex<
the left frontal, parietal, and occipital lobes. The MR lesions demonstrated diffuse 9Z3Vf[n5\
increased signal on DWI (diffusion-weighted images) and normal to low signal on ADC #rp)Gc
(apparent diffusion coefficients). Contrast-enhanced T1 images were unremarkable. y@Td]6|f
Lumbar puncture revealed a mild elevation in cerebrospinal fluid (CSF) protein. CSF SV^[)p)
PCR assay for viral DNA fragments were negative on two occasions. Serum serology for x7
xQrjE
HIV was negative as well. A brain biopsy was subsequently performed. The clinical and mk6>}z*
neuroimaging differential diagnoses as well as neuropathologic correlation are presented. ^a#W|-:
In vitro-generated mesenchymal stem cells (MSCs) initially attracted interest for their KnK\X>:
ability to undergo differentiation toward cells of different lineages. &@qB6!^
These results suggested that c{jTCkzq
However, there are still obstacles in 0 Gq<APtr
The major challenge for successful drug development is identifying delivery strategies W@~a#~1O
that can be translated to the clinic. mH'om
SCz
This review will discuss progress in developing and testing small RNAi-based drugs and 0X%#9s~
potential obstacles. 8=mx5Gwz-
This review highlights what mf2Qu
In addition, there are indications that X C'|
Proper consideration of all of these issues will be necessary in sT91>'&
These studies provide YO;@Tj2)x
This paper presents the potential applications and the hurdles facing anti-HCV siRNA a%wa3N=v
drugs. 5"Y:^_8
The present review provides insight into the feasible therapeutic strategies of siRNA ~e+pa|lO
technology, and its potential for silencing genes associated with HCV disease. KU_""T
4 q)tNH/
A basic problem in the design of xx is presented by the choice of a xx rate for the nB%[\LtZ?
measurement of experimental variables. IZxr;\dq6
This paper examines a new measure of xx in xx based on fuzzy mathematics which 0|(6q=QK
overcomes the difficulties found in other xx measures. fc%C!^7
This paper describes a system for the analysis of the xx. -nB.
.q
The method involves the construction of xx from fuzzy relations.
bWMb@zm
The procedure is useful in analyzing how groups reach a decision. p$6L_
*$
The technique used is to employ a newly developed and versatile xx algorithms. ^i17MvT'
The usefulness of xx is also considered. A)kdY!}
A brief methodology used in xx is discussed. ymA8`k5>@
The analysis is useful in xx and xx problem. N\zUQ
J
A model is developed for a xx analysis using fuzzy matrices. RIF*9= ,S
Algorithms to combine these estimates and produce a xx are presented and justified. D*)"?LG
The use of the method is discussed and an example is given. }9L;|ul6
Results of an experimental applications of this xx analysis procedure are given to iD:TKB_r
illustrate the proposed technique. 0JLQ.%_
This paper analyses problems in vNAQ/Q
This paper outlines the functions carried out by ... IHe?/oUL"b
This paper includes an illustration of the ... R%;dt<Dh
This paper provides an overview and information useful for approaching }yM!o`
90
Emphasis is placed on the construction of a criterion function by which the xx in S!7|vb*ko
achieving a hierarchical system of objectives are evaluated. 8' +I8J0l
The main emphasis is placed on the problem of xx IPlkv{^
Our proposed model is verified through experimental study.
4-q8:5
The experimental results reveal interesting examples of fuzzy phases of : xx,xx (EOYJHZB!
The compatibility of a project in terms of cost, and xx are likewise represented by k)S'@>n{u
linguistic variables. /3d6Og
A didactic example is included to illustrate the computational procedure H`8}w{ft&
Introduction 引证核心文献,提出假设,指出文章的核心观点 s!/Q>A
Beginning (Bu-o((N@0
Over the course of the past 30 years, .. has emerged form intuitive stlkt>9
We evaluated 508 participants who RMBPm*H
Acute kidney injury (AKI) is associated with an increased incidence of respiratory failure Z~DR,:
requiring mechanical ventilation, which greatly increases mortality (/Dr=D{ `
The cause of respiratory failure in patients with AKI is incompletely understood YW^sf,zQ
However, lung injury also occurs after ischemia–reperfusion injury of other organs such $U}GX'1LZ
as the liver, gut, and hind limb =BBDh`$R
We have demonstrated previously that |kkg1M#
Given this background, we hypothesized that
:<`po4/
we demonstrate that N(L?F):fT
Technological revolutions have recently hit the industrial world FFID<Lf/2
The advent of ... systems for has had a significant impact on the #Ue_
5 !Ytr4DtM
The development of ... is explored %jmL
#IN)
The concept of xx was investigated quite intensively in recent years Y`
tB5P
There has been a turning point in ... methodology in accordance with the advent of ... Ct 30EZ
A major concern in ... today is to continue to improve... hZLwg7X!
It has become increasingly clear that ($Ck5`_MK
In this paper, we focus on the need for wx)Yl1C
This paper proceeds as follow. p>GxSE)
The structure of the paper is as follows. hha^:,
Our study [5TGCGxP{
In this paper, we shall first briefly introduce… (uskVK>L
To begin with we will provide a brief background on the :I^I=A%Pe(
This will be followed by a description of the xx of the problem and a detailed %oqC5O6
presentation of how the required membership functions are defined. O#S27.
Details on xx and xx are discussed in later sections. qx<h rC0Z&
Polyphenolic compounds are vasodilators and help to lower the risk of cardiovascular E]j2%}6Z%
diseases. DZ~qk+,I
Taken together, our novel findings suggest that the EDR induced by the strawberry l|p
\8=
extract was mediated by activation of the PI3 kinase/Akt signaling pathway, resulting in Q7@.WG5
phosphorylation of eNOS. 86N"EuH$
Objective / Goal / Purpose o>}fKg<
The purpose of the inference engine can be outlined as follows: ([a[fi
The ultimate goal of the xx system is to allow the non;experts to utilize the existing ?oO<PR}y
knowledge in the area of manual handling of loads, and to provide intelligent, }hd:avze
computer;aided instruction for xxx. NRgNW1#
The paper concerns the development of a xx yDW$v/j.|
The scope of this research lies in `cBV+00YS
The main theme of the paper is the application of rule;based decision making. WbW@V_rr
These objectives are to be met with such thoroughness and confidence as to permit ... WYklS<B[
The objectives of the ... operations study are as follows: dy%#E2f
The primary purpose/consideration/objective of DoA+Bwq@
The ultimate goal of this concept is to provide kLw07&H
The main objective of such a ... system is to 1^4z/<ZWm
The aim of this paper is to provide methods to construct such probability distribution. b7_uT`<
In order to achieve these objectives, an xx must meet the following requirements: g-Y2U}&
In order to take advantage of their similarity s]z-d!G
more research is still required before final goal of ... can be completed ]c'12 g]h
In this trial, the objective is to generate...
q`8M9-~
for the sake of concentrating on ... research issues 8I`t`C/
4
A major goal of this report is to extend the utilization of a recently developed procedure QXcSDJ
for the xx. s;'jn_,0
For an illustrative purpose, four well;known OR problems are studied in presence of MWxv\o
fuzzy data: xx. ]
3@.)
6 4G4[IAu_
This illustration points out the need to specify VdZmrq;?/
Recent studies have further defined the role of SBP-2 in promoting UGA read-through, !F_BLHig
This concept has been further validated with the discovery of patients with impaired _*I@ J/
deiodinase activity due to a mutation in SBP-2 !5;A.f
The ultimate goal is both descriptive and prescriptive. "#a_--"k9
A wealth of information is to be found in the statistics literature, for example, regarding ?{OB+f}Mo
xx "XEKoeG{
This review will focus on the most recent progress achieved in this field, particularly the dBKceL v
cellular and molecular aspects of local control of thyroid hormone signaling provided by vIi#M0@N
deiodinases. 8U5L|Ny.q
A considerable amount of research has been done .. during the last decade .UUY9@
A great number of studies report on the treatment of uncertainties associated with xx. Ie[8Iot?bn
There is considerable amount of literature on planning ?5A!/`E&%
However, these studies do not provide much attention to undertainty in xx. pa6.Tp>
Since then, the subject has been extensively explored and it is still under investigation as sMq*X^z
)?
well in methodological aspects as in concrete applications. `Eijy3>h
Many research studies have been carried out on this topic. us2X:X)
Problem of xx draw recently more and more attention of system analysis. nnV(MB4z1
Attempts to resolve this dilemma have resulted in the development of |-W7n'n
Many complex processes unfortunately, do not yield to this design procedure and have, xMAfa>]{n
therefore, not yet been automated. ZZ<uiN$
Most of the methods developed so far are deterministic and /or probabilistic in nature. bF#* cH
The central issue in all these studies is to vakAl;
The problem of xx has been studied by other investigators, however, these studies have SA| AS<
been based upon classical statistical approaches. {c'2{`px 5
Applied ... techniques to B>hC8^.S|w
Characterized the ... system as #+vIq?
Developed an algorithm to
;^q@w
Developed a system called ... which :
"|M
Uses an iterative algorithm to deduce [7Yfv
Xp
Emphasized the need to u}eqU%
Identifies six key issues surrounding high technology %>dCAj"
A comprehensive study of the .. has been undertaken Z'P>sV
Much work has been reported recently in these filed q K sI}X~
Proposed $*035f
Presented Osb#<9{}
State that
_I$\O5
Point out that the problem of i@=0fHiZQ
Described xz-z"
8d
Illustrated
tOJK~%'
Indicated Hm>M}MF3
Has shown / showed ~i)m(65:
Address +d7sy0
7 5pF4{Jd1
Highlights *SW.K{{
A study on ...was done / developed by [] ^BDM'
Previous work, such as [] and [], deal only with 6}Se$XMl
The approach taken by [] is MIblx
The system developed by [] consists D(EY"s37
A paper relevant to this research was published by [] >k:BG{$Kae
[]'s model requires consideration of .. J^}w,r*=
[]' model draws attention to evolution in human development 8<,b5
[]'s model focuses on... c4]/{!4 Q
Little research has been conducted in applying ... to \E9Hk{V:6
The published information that is relevant to this research... .~)[>
This study further shows that aNZJs<3;'D
Their work is based on the principle of ds@w=~
More history of ... can be found in xx et al. [1979]. AJ0
qq
Studies have been completed to established Ix+===6
The ...studies indicated that <SiD m-=E
Though application of xx in the filed of xx has proliferated in recent years, effort in 4nC`DJ;V
analyzing xx, especially xx, is lacking. e-$U .cx
提出Problem / Issue / Question 或假设 68m (%%E@
Unfortunately, real-world engineering problems such as manufacturing planning do not nWTo$*>W
fit well with this narrowly defined model. They tend to span broad activities and require [ \I&/?On
consideration of multiple aspects. g+5{&YD
Remedy / solve / alleviate these problems ]= 2wQ8
It has recently been reported that SU0K#:
... is a difficult problem, yet to be adequately resolved l djypEa}
Two major problems have yet to be addressed ]LF Y2w<
An unanswered question X~/hv_@
This problem in essence involves using x to obtain a solution. t;P%&:"@M
An additional research issue to be tackled is .... gu+c7qe
Some important issues in developing a ... system are discussed C-@
The three prime issues can be summarized: E?c)WA2iH
The situation leads to the problem of how to determine the ... F
s^d-I
There have been many attempts to hg}Rh
It is expected to be serious barrier to tw.2h'D
It offers a simple solution in a limited domain for a complex problem. >G`=8Ku
There are several ways to get around this problem. 3VJoH4E!6
As difficult as it seems to be, xx is by no means new. WNkAI9B
The problem is to recognize xx from a design representation. ZN)a}\]
A xx problem can trace its roots to xx. b* 4[)Yg4
xx [1987] used a heuristic approach to simplify the complexity of the problem. OtuOT=%
Several problems are associated with them. Xrnxpp!#^D
Although some progress has been made in this area, at least two major obstacles must be Wc4K?3 ZM
overcome before a fully automated system can be realized. : 0BaEqX
Most problems in practice are complicated
WeGT}
More problem surface here. Lu&2^USTO
Hamper effort toward a xx system Zf<M14iM
In order to overcome the limitations due to incomplete and imprecise xx knowledge, a xx ]Xcqf9k
program has been developed, which bases its knowledge upon the statistical analysis of a D$k40Mz
sample population of xx }a@ZFk_>
The above difficulties are real challenges faced by researchers attempting to develop q_Td!?2?
This type of mapping raises no controversy to the issue of membership function A:3bL:
;t
determination. 8ID
fYJ
However, attempts to quantify the xx have met both theoretical and empirical problems. T2#
W=P
It has become apparent that in order to apply this new methodological framework to X<s']C9c
real;world problems and data, we have to pay attention to the problems of xx and xx. ^.Y"<oZSS
MATERIALS AND METHODS wC@5[e$
Materials }zVPdBRfm
Chemicals were purchased from Sigma (St Louis, MO), if not stated otherwise. VHXvm*
Experiments were conducted in accordance with the NIH Guidelines for the Care and Use rkA0v-N6v
of Laboratory Animals. gkS#=bv9e@
CsA, EGF, PD98059, U0126, AG1478, Wortmannin, and LY294002 were from m`UNdFS
Calbiochem (San Diego, CA, USA). Anti-ERK1/2 and anti-Ras were from Transduction 'UO,DFq[Fl
Laboratories (Franklin Lakes, NJ, USA). Anti-phospho Raf-1 (Ser259), anti-phospho D/hQ{T
Raf-1 (Ser338), anti-phospho PKB/Akt (Ser473), anti-PKB, anti-phospho EGFR (Tyr1068), WAiEINQ^)
anti-phospho ERK1/2 (Thr202/Tyr204), anti-PI3K 110 , anti-p53, and anti-phospho j(G}4dib
MEK1/2 (Ser217/221) were from Cell Signalling (Danvers, MA, USA). Anti-MEK and yEt :g0Z\
anti-Raf-1 (C12) were from Santa Cruz (Santa cruz, CA, USA). Apigenin and all other i> Ssp
reagents were from Sigma (Saint Louis, MO, USA). }*
l V
Animal le`&VdE^
Eight- to ten-week-old male C57BL/6 mice (wild-type) and IL-6-deficient mice ?}sh@;]*h
backcrossed over eight generations on a C57BL/6 background were used ?}%Gr,tj2
Mice were maintained on a standard diet and water was made freely available. j[YzBXd
V
All experiments were conducted with adherence to the NIH Guide for the Care and Use ~,yHE3B\G
of Laboratory Animals. 9z5K -s
The animal protocol was approved by the Animal Care and Use Committee of the N)A?*s'v~
University of Colorado CtVY;eG
Three surgical procedures were performed as described previously:5 (1) sham operation, #"d.D7nA
(2) ischemic AKI, and (3) bilateral nephrectomy. hi,!
The abdomen was closed in one layer. {s|rk
Sham surgery consisted of the same procedure except that clamps were not applied.
9Qp39(l:
9 .z+?b8Q\
For bilateral nephrectomy, renal pedicles were tied off with suture and then cut distally. o#E 3{zM
The ureters were pinched off with forceps and the kidneys removed. 1Nx.aji
Serum was collected as described previously.5 Blood urea nitrogen and creatinine were bJe*J\){
measured using an autoanalyzer (Beckman Instruments, Fullerton, CA, USA). &$ F0
Serum IL-6 was measured by ELISA according to assay instructions (R&D Systems, "|`8mNC
Minneapolis, MN, USA). "5e~19
Five-micrometer sections of paraffin-embedded lung tissue were stained with C1P{4 U
hematoxylin and eosin using standard protocols. Neutrophils were counted on the basis of S5d:?^PGg
morphological criteria; at least 50 high-powered fields ( 40) were counted per slide. N+l~r]: &
Frozen lung was prepared for ELISA as described previously.5 Supernatants were tx&>Eo
analyzed for protein content using a Bio-Rad DC protein assay kit (Hercules, CA, USA). `|wH=
KC and MIP-2 were determined by ELISA (R&D Systems, Minneapolis, MN, USA). 2F^
%d9`
One-fourth lung was used to determine MPO activity as described previously. PC/fb-J
Frozen lung was homogenized in radioimmunoprecipitation assay buffer with protease TW).j6@f
inhibitor; western blotting was performed as described previously.49 Goat anti-murine sF]v$kq
ICAM-1 polyclonal antibody (R&D Systems, Minneapolis, MN, USA; 1:2000) or rat l9)iLOj
anti-murine VCAM-1 monoclonal antibody (R&D Systems; 1:1000) were used. QL}5vSl
A total of 20 g anti-IL-6 antibody vs IgG control (eBioscience, San Diego, CA, USA) KSVIX!EsX
was administered to wild-type mice by tail vein injection 1 h before surgery, j2lo~J)
intraperitoneally at the time of clamp removal (ischemic AKI) or nephrectomy (bilateral 1O45M/5\o
nephrectomy) and intraperitoneally 1 h following surgery (60 g total). M
! gX4
Experimental groups KoiU\r
STZ-induced diabetic rats, a model of partial type I diabetes: SD rats received a single EG&^;uU
intraperitoneal injection of freshly prepared STZ (65 mg kg-1 body weight, dissolved in EVN
Tn`J_
100 mmol l-1 citric acid, pH 4.5), and confirmed 2 days later by PP blood glucose PTA;a0A
(>250 mg dl-1). Zqd&EOm
CTR rats: Vehicle-injected SD rats after 2 to 7 days, 14 to 30 days, and 90 days served as *]z.BZI:
CTR for the 2 and 7 days STZ, the 14 and 30 days STZ, and for the 90 days STZ, +^gh3Y
respectively. /}2
bsiJT
Insulin treatment in STZ: Glc was normalized in seven animals during 12–14 days of T =3te|fv
STZ by subcutaneous insulin implants (2U day-1; Lin Shin Canada, Ontario, Canada). sxgR;gf6
Cell Culture dVVeH\o
Immortalized cells from the convoluted portion of mouse kidney proximal tubule Jkpw8E7
PKSV-PCT cells (PCT3 clone) were cultured in a medium A (DMEM/Ham's F12 (1:1, @5
kKMz
v/v), 20 mM HEPES, 2 mM L-glutamine, 12.5 mM D-glucose, 60 nM sodium selenite, FO_nS
5 g ml-1 transferrin, 50 nM dexamethasone, 100 U ml-1 penicillin, and 100 g ml-1 vbqI$F[s
streptomycin), supplemented with 2% fetal bovine serum, 5 g ml-1 insulin, 10 ng ml-1 tt[P{mMQ
EGF, and 1 nM triiodothyronine at 37°C in a 95:5 air/CO2 water-saturated atmosphere. MP[v 9m@
For all experiments, cells were seeded at 0.2 106 cells/ml and after 24 h with complete n8[sR;r5f
medium cells were starved for 16 h in medium A supplemented with 0.1% fetal bovine &-<"HW
10 ol!o8M%Q
serum but not insulin, EGF, or triiodothyronine. CsA was dissolved in ethanol and all the ||`w MWq
pharmacological inhibitors were in DMSO. In all cases, controls were carried out with H!F'I)1
cells treated with the corresponding vehicle alone. After treatments, cells were washed dadOjl)S)
twice with cold phosphate-buffered saline (PBS) and harvested with lysis buffer as in T~"tex]
Llorens et al W{ eu_
Cell viability OOl{
After treatments, PCT3 cells were harvested and washed twice with cold PBS, and the #Yw^n?~~
viable cells were counted with Trypan Blue Dye (Gibco-Life Technologies, Grand Island, FAM`+QtNw
NY, USA) in a Neubauer chamber. Living cells exclude the dye, whereas dead cells will ~e{2Y%
take up the blue dye. For Hoechst staining, cells seeded in six-well dishes were washed qu[w_1%S
twice with PBS and fixed for 15 min with 4% paraformaldehyde at room temperature. ~|DF-t
V
Then, cells were washed twice again with PBS and stained with Hoescht (5 g ml-1 in GZZLX19sq
PBS) for 5 min. '0t j
2
Western blots/ Immunoblot Vaha--QB
The protein content of cellular extracts was quantified by the Bradford assay.44
n:wn(BC3
Twenty-five microgram of total cell extract protein was run on SDS-polyacrylamide gel l06 q1M 3
electrophoresis gels, transferred onto polyvinylidene difluoride membranes, and 44%H? ,d
incubated with the corresponding antibodies. The membranes were developed with the m9L+|r
enhanced chemiluminescence method (Pierce, Rockford, IL, USA). M<ad>M
Supernatants of growing or growth-arrested cells were centrifugated for 5 min at 10 000 g. %i.|bIhmm
The cells were lysed as described. The proteins from supernatant and cell lysates were T&R`s+7
concentrated using heparin sepharose. The heparin sepharose was washed four times with XX6&%7(
phosphate-buffered saline containing protease inhibitors, dissolved in phosphate-buffered d\)v62
P
saline/protease inhibitor and incubated with 500 g protein over night at 4°C. The etTuukq_Z
complexes were washed with phosphate-buffered saline/protease inhibitor and the 3M@>kIT8
proteins were eluated with 100 l Laemmli buffer without bromophenol blue (10 min @W.`'b-
95°C). A 30 l probe was loaded in each lane and western blot analysis was performed as 5Q%#Z
L/'
described, using a polyclonal antibody against CCN3 (K19M), which recognizes a sm_:M| [D
C-terminal 19-aminoacid peptide of human CCN3. As a positive control, a supernatant htF&VeIte
from adrenocortical cell cultures, which are known to secrete CCN3, was used. Ce0I8B2y
Cells were lysed in 0.5% (volume/volume) Triton X-100 lysis buffer and immunoblot }s)Z:6;(,q
analysis was done as described43. Immunoprecipitation with anti-CrkL or control rabbit RtIc:ym
antiserum was done as described44. Antibodies to the following were used: +\W"n_PPy
phosphorylated Erk (910L; Cell Signaling); phosphorylated Jnk (V7932; Promega); Erk JQtH},Tr
(13-6200; Zymed); Jnk1 (sc-474), H-Ras (sc-35), C3G (sc-869), CrkL (sc-319), JHQ8o5bEQp
RasGRP1 (sc-8430) and DGK- (sc-8722; all from Santa Cruz Biotechnologies); and SHGO;
DGK- (a gift from H. Kanoh, Sapporo Medical University, Sapporo, Japan). Images ':>B%k
were scanned, followed by densitometry analysis with UN-SCAN-IT software (Silk xJ"KR:CD>
Scientific). p0tv@8C>
11 z N
t7DK
Purified splenic T cells were stimulated for various times with 5 g/ml of anti-CD3 4/h2_
(500A2; BD Pharmingen) and were lysed in 1% Nonidet P-40 lysis buffer (1% %bi
mcRX#W
(volume/volume) Nonidet-40, 150 mM NaCl and 50 mM Tris, pH 7.4) with protease )ld7^G
inhibitors. Proteins were resolved by SDS-PAGE and were transferred to a Trans-Blot .Gv~e!a8
Nitrocellulose membrane (Bio-Rad Laboratories); membranes were probed with zJsoenU
antibodies specific to phosphorylated Erk (91015; Cell Signal Technology) and x$Dv&4
phospholipase C- 1 (05-163; Upstate Biotechnology). Membranes were stripped and ?UxY4m%R;
were reprobed for analysis of total Erk (SC-16982; Santa Cruz Biotechnology). Activated <VBw1|)$@
Ras in cell lysates was determined by glutathione S-transferase–Raf—Ras-binding $YC~02{
domain precipitation assay as described =QC^7T
Immunofluorescence microscopy. =;`YtOL
Analysis of protein localization in 2C T cell–P815.B71 cell conjugates was done as 7 dzE"m
described29. P815.B71 cells were labeled with CMAC (7-amino-4-chloromethylcoumarin) OMZT\$9yT
Cell-Tracker Blue (Molecular Probes) and were mixed with equal numbers of anergic or P$QjDu-
in vitro–primed 2C Rag2-/- T cells. After approximately 8 min, cells were fixed, were U\
L"\N 7
made permeable and were stained with anti-GRP1 and anti-talin (Santa Cruz s +GF-kJ*
Biotechnologies) and with species-specific secondary antibodies conjugated to }ot _k-
fluorescein isothiocyanate or phycoerythrin, respectively. Samples were analyzed with a em]K7B=
Zeiss Axiovert 100 microscope, and 15 conjugates were typically assigned scores. S?{5DxilO
Slidebook software (Intelligent Imaging Innovations) was used for image capture and
j{^(TE
deconvolution analysis. ImageJ 1.36b software (US National Institutes of Health) was [s/@z*,M1
used for quantification of pixel intensity. Wk|z\OR(
Measurement of ROS generation moR]{2Cd{
The assay is based on the incorporation of 2',7'-dichlorofluorescein diacetate into the cell. G4}q*&:k
H2O2 and peroxidases are able to oxidize the cleaved DCFH to DCF, which is highly X2`>@GR/>
fluorescent at 530 nm. To measure CsA-induced ROS generation, cells were washed Z]Y4NO;
twice with PBS, and fresh medium containing 20 M 2',7'-dichlorofluorescein diacetate x.yL'J\)
was added to previously treated cells. After 30 min cells were washed again, tripsinized, 6ZR0_v;TD
and resuspended with cold PBS. Fluorescence was measure by flow cytometry on a Ig<p(G.;}
FACScan flow cytometer.
@NIypi$T
Raf-1 activity 2X*<Fma3C
Raf-1 immunoprecipitation and kinase assay were performed as described previously.45 Ic}o
fBK
Immunoprecipitated Raf was incubated for 30 min at 30°C with 0.8 mM ATP, 10 g ml-1 TJpv"V
GST-MEK, and 100 g ml-1 GST-ERK2. An aliquot of the supernatant was used for @QG1\W'
ERK2 activity assays using 0.5 mg ml-1 myelin basic protein and 0.1 mM [ -32P] ATP PR?clg=z
(400 c.p.m. pmol-1). After 15 min incubation at 30°C, 12 l of 5 Laemmli loading a,~P_B|@
buffer was added to the tubes and the mixture analyzed by SDS-polyacrylamide gel 0I((UA/7Zs
electrophoresis. Radiolabeled bands were quantified in a PhosphoImager. ,*[LnR
12 1%"`
=$q%
Semiquantitative RT-PCR. >#?: x*[
Total RNA was isolated from freshly isolated thymocytes. Then, cDNA was prepared At(9)6n8
with the M-MuLV reverse transcriptase and random primers according to the .Qt3!ek
manufacturer's recommendations (New England Biolabs). Semiquantitative PCR analysis \NU[DHrMP
of Tcrb VDJC (where 'C' is the constant region) and Cd3e cDNA was done as described51. cEdJn@ ,
[32P]dCTP (GE Healthcare Life Science) was incorporated into PCR products for )F9r?5}v4x
semiquantitative detection by autoradiography. fZ}Y(TG/
Real-time quantitative RT-PCR ?MM3LA! <
Total RNA was isolated from HMC or rat mesangial cells using the Invisorb Spin SAh054/St
Cell-RNA Mini Kit (Invitek, Berlin, Germany) or from isolated glomeruli using the n-3j$x1Ne
RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA purity determination, cDNA A.9'pi'[9Q
synthesis, and RT-PCR were performed as described.16 Primer sequences are listed in ==1/N{{R
Table 2. Glyceraldehyde-3-phosphate dehydrogenase cDNA amplification was used as an VtiqAh}4
internal standard. WG
!t!1p
Total RNA was isolated from the frozen kidneys as described by Chomczynski and DXW?;|8)O
Sacchi47 and quantified by a photometer. One microgram of the resulting RNA was used "jO3Y/>S
for reverse transcriptase (RT)-PCR. The cDNA was synthesized by MMLV reverse +esNwz_
transcriptase (Superscript-Invitrogen, Carlsbad, CA, USA). For quantification of renin O6,"#BX
mRNA expression (sense: 5'-ATGAAGGGGGTGTCTGTGGGGTC-3', antisense: arS'th:j
5'-ATGCGGGGAGGGTGGGCACCTG-3'), real-time RT-PCR was performed using a FJ~_0E#L
Light Cycler Instrument (Roche Diagnostics Corp., Basel, Suisse) and the QuantiTect MW$H/:3
SYBR Green PCR kit (Qiagen, Hilden, Germany), with GAPDH (sense: /lB0>Us
5'-TTCATTGACCTCAACTACAT-3', antisense: 5'-GAGGGGCCATCCACAGTCTT-3') <hZ}34?]i2
as a control. PCR was run for 30 cycles with 15 s per 95°C denaturation, 20 s/58°C '0')6zW5s
annealing and 20 s/72°C elongation. To verify the accuracy of the amplicon, a melting %;(|KrUN
curve analysis was done after amplification.Total renin mRNA content per kidney was ht3T{4qCS
calculated from the yield of RNA extracted from the whole kidneys times the renin 8o7]XZE=)
mRNA estimate obtained from the defined amount of RNA used for RT-PCR real time &U$8zn~[k
measurement. For the RT-PCR real-time measurements, a pool of RNA from adult mouse %C`'>,t>
kidneys was generated, which served as standard for all RT-PCR runs. Thus, all renin Eqm
v`Z
[_
mRNA levels for the developing kidneys were estimated relative to the levels in adult MAe<.DHY
kidneys. BQ9`DYI b
In vitro anergy assay. f:[d]J|
Wild-type, Dgka-/- and Dgkz-/- splenocytes were stained with 5 M CFSE, were jUJTcL
stimulated for 72 h with anti-CD3 (1 g/ml; 2C11) along with CTLA-4–Fc (5 g/ml), >}DjHLTW\
were stained with allophycocyanin-conjugated anti-CD4 and were analyzed by flow N _~KZQ11^
cytometry. Cell division was assessed by CFSE dilution after gating on live CD4+ cells. 0^y@p&;/.
Alternatively, cells were stimulated for 72 h and were pulsed with 1 Ci/well of qSoBj&6y
[3H]thymidine for the final 8 h of stimulation, and proliferation was assessed by tritium _Hd1sx
incorporation with a scintillation counter. For restimulation analyses, cells were ?$J7%I@
13 L_U3*#Zdz7
prestimulated with anti-CD3 plus CTLA-4–Fc, then after 72 h, CD4+ cells were purified 5G'&9{oB
by negative selection (with fluorescein isothiocyanate–conjugated anti-CD8, anti-B220 1( ?CNW[
(RA3-6B2; BD Pharmingen), anti-DX5 and anti-CD11b (M1/70; BD Pharmingen), !q-:rW?c
followed by depletion with anti–fluorescein isothiocyanate magnetic beads) and were 2JA&{ch
allowed to 'rest' overnight at 37 °C. Live cells were then counted by Trypan blue (Gi+7GMV'
exclusion, and equivalent numbers of live cells were dropped onto monolayers of bone PUE'Rr(Q
marrow–derived macrophages coated with anti-CD3 (1 g/ml) and anti-CD28 (0.5 ST:
v3*
g/ml). After 24 h, supernatants were collected and IL-2 was quantified by ELISA r ,3Ww2X-
according to the manufacturer's protocol (R&D Systems). \za5:?[xB
Three-dimensional reconstruction ti{H(;;@
Serial sections of kidney specimens were fixed and stained for renin and for SMA as Ufaqhh
described above. Digitalization of the serial slices was performed using an AxioCam n b0 Py>4
MRm camera (Zeiss, Jena, Germany) mounted on an Axiovert200M microscope (Zeiss) + q
#Xy0u
with fluorescence filters for renin and SMA (TRITC: filter set 43: Cy2: filter set 38 HE; \3Q:K|
Zeiss). After acquisition, a stack of equal-sized images was built using the graphic tool Y8J;+h9
ImageJ (Wayne Rasband, NIH, Bethesda, MD, USA). The equalized data were then .7pGx*WH^Y
imported into the Amira 4.1 visualization software (Mercury Computer Systems Inc., FVsu8z u
Chelmsford, MA, USA) on a Dell Precision 690 computer system (Dell, Frankfurt, %A)-m 69
Germany), and subsequently split into the renin and SMA channels. After this step, the ]cF1c90%
renin and SMA channels were aligned. In the segmentation step, the SMA and renin Yg=E@F
data sets served as a scaffold and were spanned manually or automatically using r/CEYEJ&X
grayscale values. Matrixes, volume surfaces, and statistics were generated from these 3x"@**(Q
segments. W{fULl
Restimulation assay after in vivo immunization. ^8?j~&u$F
For analysis of T cell priming in vivo, CD4+ T cells were collected from naive, primed or #<a_: m)@
tolerized recipient mice on day 15 after immunization. Proliferative responses were ~K5Cr
measured by culture for 72 h of CD4+ T cells (3 106 cells/ml) with irradiated (3,000 rads) !lQ#sL`
APCs (10 106 cells/ml) and OVA(323–339). The number of KJ1-26+ cells for each c
}<*~w;
group of recipient mice was determined by flow cytometry and proliferation was j+_S$T8w
normalized to the number of input KJ1-26+ cells. Supernatants were collected from plates .9T.3yQ
and cytokine concentrations were measured by ELISA. )"(V*Z
Flow cytometry. X'V+^u@W
For analysis of surface antigen expression, mAb to CD4 (JK1.5; eBioscience) and mAb tWpl`HH
KJ1-26 (KJ-126; Caltag) were used. For intracellular IL-2 staining, T cells were eaV3)uP
restimulated for 24 h in vitro with OVA(323–339) in the presence of APCs as described V/aQ*V{
above. Brefeldin A (eBioscience) was added for the last 6 h of the culture. Cells were 'R^iKNPs
collected and were stained with allophycocyanin-conjugated mAb to CD4 and fluorescein G_V.H\w
isothiocyanate–conjugated mAb KJ1-26. Then, cells were fixed, were made permeable r_4TtP&UW
and were stained with antibody to IL-2 (clone JES6-5H4; eBioscience) according to the 2Ryp@c&r^
manufacturer's instructions. kx|me~I
14 oJP<'l1
TH1 cells transduced with adenovirus vector encoding GFP were analyzed with a |'ZN!2u
FACScan (BD Biosciences). A total of 1 104 events were acquired, and data were !+m@AQ:,
analyzed with CellQuest software (BD Biosciences). /VRUz++K
Splenic and lymph node samples depleted of thymocytes and red blood cells were stained T1l&B
with fluorescence-conjugated anti-CD3 (2C11), anti-CD4 (GK15), anti-CD8 (53-6.7), (FM4 ^#6
anti-CD25 (7D4) and anti-CD44 (552407; all from BD Pharmingen). A three-color @Ppo &>
FACScan (Becton Dickinson) was used for flow cytometry, and data were analyzed with E::L?#V
FlowJo 4.6 (TreeStar). 3"5.eZSOW
A FACSCalibur (Becton Dickinson) was used for flow cytometry. Human cells from $np=eT)
transplanted NOD-SCID mice were assessed with phycoerythrin–cyanin 5–conjugated a]`itjL^
anti–human CD45 and phycoerythrin-conjugated anti-CD19, anti-CD33, anti-CD36 and K6E}";;
anti–glycophorin A (Becton Dickinson). EGFP fluorescence was detected with channel rqF"QU= l
FL1 calibrated to the fluorescein isothiocyanate emission profile. During quadrant Z,3 CC \
analysis, only fluorescence excluding more than 99% of isotypic control events was W3^.5I
considered specific. Cell Quest Pro software (Becton Dickinson) and FlowJo (Tree Star) 7krh4
were used for data acquisition and analysis. QO@6V
Y@
Mammalian expression plasmids and transfection. Po> e kz_E
For generation of the plasmid expressing Smad3 shRNA, the following specific 7k `_#
oligonucleotides were used: upper, s,w YlVYf!
5'-GATCCACCTGAGTGAAGATGGAGATTCAAGAGATCTCCATCTTCACTCAGG Yr+d1(
TTTTTTTACGCGTG-3'; lower, q'.;W@m
3'-AATTCACGCGTAAAAAAACCTGAGTGAAGATGGAGATCTCTTGAATCTCCA ;J'OakeVO
TCTTCACTCAGGTG-5'. These were cloned under control of the U6 promoter into the ?!H)zz6y
pSIREN-DNR-DsRed expression vector (Clontech, BD). Vector expressing shRNA J2'K?|,m
specific for luciferase served as a control. Smad3-Tm was subcloned into the NS Np
pIRES2-EGFP vector (Clontech, BD); empty vector served as a control. Purified }hCaNQ&jH
DO11.10 or DO11.10p27 T cells were transfected with plasmids by nucleofection with p zg&/m&F`
the Amaxa nucleofection apparatus, according to the manufacturer's instructions (Mouse 7gm:ZS
T Cell Nucleofector Kit Amaxa Biosytems). Purified T cells were suspended in ' X}7]y
nucleofector solution (3 106 cells/100 l) and were mixed with 3 g of plasmid. dQai4e>[
Samples were transferred into cuvettes, were transfected with nucleofector program X-01 }%+qP+O\
and were then immediately transferred into 12-well plates and were cultured in LP ,9<&"<
nucleofector medium for 3 h. Then, cells were collected and counted and were o_O+u%y
immediately transferred into syngeneic recipient mice (3 106 cells per mouse). At 3 h l&3ki!
after adoptive transfer, mice were given priming or tolerizing treatment in vivo according *qG$19b
to the standard protocol described above. Lymphocytes were isolated from draining OTE<x"=h
lymph nodes at day 5 of the treatment, CD4+ T cells were purified and transfection ?gN9k
d)
efficiency was assessed by flow cytometry. The range of transfection efficiency was D
M}s0O$0
69–75% (Supplementary Fig. 4 online). Smad3-knockdown and control-knockdown S*g`d;8gV
DO11.10 cells and DO11.10 cells transfected with Smad3-Tm and vector control were SW#BZ3L
selected by cell sorting. The resulting CD4+ T cells (2 106 cells/ml) were restimulated 6b<+8w
with OVA(323–339) (5 g/ml) in the presence of irradiated APCs in vitro. b_l3+'#ofM
15 UWw}!1
Luciferase assays. H}
6CKP}
CAR IL-2–Luc TH1 clones were transduced with vectors, were stimulated for 20 h and waCboK'
were resuspended in serum-free DMEM in luminometer cuvettes (BD Biosciences). An TP{Gt.e
equal volume of Bright-Glo luciferase assay reagent (Promega) was added to each sample, .'/l'>
followed by thorough mixing. After 2 min, samples were analyzed with a monolight 2010 sP y2/7Wqd
Luminometer (BD Biosciences). U` hfvTi
Analysis of cell divisions in vivo. ,1
P[
Purified T cells from DO11.10 and DO11.10p27 mice (10 106 cells/ml) were labeled 4V$fGjJ3
for 30 min at 37 °C with the intracellular fluorescent dye CFSE (5 M 5(and [4XC#OgA
6)-carboxyfluorescein succunimidyl ester; Molecular Probes). Then, cells were washed 'gDe3@ci!
twice with cold RPMI 1640 medium containing 10% FCS, were resuspended in PBS and
c#QF
G1
were transferred intravenously into BALB/c mice (5 106 cells per mouse). Syngeneic Sl>>SP
hosts were left untreated (naive) or were treated with PBS followed by immunization \QT9HAdd@
with OVA(323–339) (primed) or with CTLA-4–Ig plus mAb to CD40L followed by [(|v`qMv/g
immunization with OVA(323–339) as described above (tolerized). Then, 3 d later, J &{xP8uq_
lymphocytes were isolated from the draining lymph nodes of the BALB/c hosts. The J>%t<xYf4
number of cell divisions on CFSE-stained cells and the percentage of cells that had M3(k'q7&:
undergone a specific number of divisions were determined as described43. Cells were also >zmzK{A=
stained with mAb KJ1-26 and CFSE analysis of KJ1-26+ T cells was done by flow sx5r(0Z
cytometry. w^{!U
Adenovirus vectors. 7tgFDLA
The cDNA encoding Ras61L was provided by F. Fitch (University of Chicago, Chicago, \zu}\{
Illinois). The dominant negative Cbl construct was generated by RT-PCR with cDNA k)":v3^
from TH1 clones as a template and the following primers (upper case, restriction enzyme `f)(Y1%.
sequences; underlining, Myc tag sequence): U=cWmH
5'-GGGGTACCatggagcagaaactcatctctgaagaggatctggccggcaacgtgaagaaga-3' (forward) and tg 85:
5'-ATAGTTTAGCGGCCGCtcaatcttgaggagttggtt cacataa-3' (reverse). The cDNA c!Dc8=nE0m
encoding DGK- was a gift from M. Topham (University of Utah, Salt Lake City, Utah) O>V(cmqE`
and was used as a template to introduce an N-terminal Myc epitope tag by PCR. The Rri`dmH
sequences of all PCR products were confirmed before subcloning. Construction of DMZ`Sx
recombinant adenovirus vectors was done with a two-cosmid system that has been u9]1X1wV
described42. V=
}1[^
Adenoviral transduction of CAR T cells. </s,pe79B
TH1 clones were purified from passage cultures by Ficoll-Hypaque centrifugation. 9y^/GwUQ
Primary CAR 2C Rag2-/- CD8+ T cells were isolated from splenocytes by negative (}gcY
selection with magnetic beads and antibody 'cocktails' (Stem Cell Technologies). CAR 6t}XJB$+7
TH1 cells were transduced with adenovirus vectors at high cell density (1 107 cells/ml) rLF*D
B3l
in DMEM containing 2% (volume/volume) FCS and were incubated for 1 h at 37 °C, HY)ESU
!
16 `Ko[r
R+
followed by an overnight 'rest' at 37 °C in DMEM containing 5% (volume/volume) FCS Y=2Un).&
at low cell density (4 105 cells/ml). 8Xn!Kpa
Lentivirus production and infection protocols. CWlW/>yF
B
A third-generation lentiviral vector encoding EGFP expressed from the human saW!9HQj
phosphoglycerate kinase promoter was used as described29, 33. Cell populations were t;47(U
incubated overnight (about 16 h) in X-VIVO-10 medium (BioWhittaker) supplemented `.^ |]|u
with 1% BSA (Stem Cell Technologies) and L-glutamine (Invitrogen) with viral U7H
9/<&o
supernatant (multiplicity of infection of 130–180). Viral concentrations of 1.0 108 to 1.8 K)[8 H~Lm
108 viral particles/ml, 2.0 107 to 4.4 107 viral particles/ml and 0.9 108 to 1.6 108 lTz6"/
viral particles/ml and cell concentrations of 0.7 106 to 1.1 106 cells/ml, 1.0 105 to 2.5 {gU&%j
105 cells/ml and 0.7 106 to 1.4 106 cells/ml for CD34+CD38lo, CD34+CD38- and Lin- 2]t i!<
cord blood, respectively, were maintained. The efficiency of gene transfer was estimated Tbf:eVIG
by progenitor cell assay as described33. \dkOK`)b
Apoptosis induction. (E!!pz
Spontaneous apoptosis of PMNs was detected after 22 h of incubation in culture media. 5 DFZ^~
In some experiments, zVAD-fmk (10-50 M), TNF (40 ng/ml), resolvin E1–methyl ester, P}r)wAt
aspirin-triggered lipoxin A4 analog, PD1–methyl ester (10 nM) or TGF- (10 ng/ml) was P!<[U!<hH
added. Vehicle treatment was 0.05% (volume/volume) ethanol. Peripheral blood T cells /Ox)|)l
were activated by incubation for 3 d in 24-well plates coated with anti-CD3 (5 g/ml; ` |Fp^gM
R&D Systems). Jurkat cells or activated peripheral blood T cells were incubated for 4–48 4JO@BV >t
h with staurosporine (1–2 M) or Fas ligand (0.05–5 ng/ml), after which cells were 5
9-!6;T
collected and used for flow cytometry or binding assays. In some experiments, )Yj%#
zVAD-fmk (10–50 M; R&D Systems) was added to cells 20 min before the addition of }5b M1h#z
apoptosis-indu %Fft
R1"
Mice strains and genotyping. )#[|hb=o
The 129/Sv Rhoh-/- mice were generated by Targeting Laboratory. The entire coding >i~^TY-&
region of mouse Rhoh is in its third exon; the targeting vector was designed to replace the (:sZ
b?*
third exon of Rhoh with a neomycin-resistance cassette. The genotypes of Rhoh DTY<0Q.
gene-targeted embryonic stem cells and transgenic mice were determined by Southern U^_D|$6
blot analysis of DNA digested with SpeI using a 5' Rhoh genomic DNA probe or by PCR A 's-'8m
analysis with primers. The 129/Sv Rhoh-/- mice were crossed with wild-type or p14 TCR Ai kf|)D[
(V 2V 8) transgenic mice on a C57BL/6J background to generate Rhoh-/- or )[&zCqDc
p14tg/+Rhoh-/- compound mice. Mice used were littermates derived from backcross Qv{,wytyO
generations with an N of more than 2. The 129S6/SvEvTac-Rag2-/- mice were purchased m*n5zi|O
from Taconic Animal Models. All animal experiments were approved by the Institutional PK:2xN:=
Animal Care and Use Committee of the Cincinnati Children's Hospital Research O\Eqr?%L)
Foundation (Cincinnati, Ohio). I=rwsL
Antibodies and GST fusion proteins. nk@atK,38^
17
BIMKsF Zt
Fluorescence-conjugated monoclonal antibodies to the following mouse antigens were \l,rpVv5m
used for flow cytometry: CD4 (RM4-5), CD8 (53-6.7), CD25 (7D4), CD44 (IM7), TCR _vl}*/=Hc
-chain (H57-597), TCR (GL3), TCR V 8, TCR V 5 (MR9-4), CD69 (H1.2F3), CD5 /q1s;I
(53-7.3), Gr-1 (RB6-8C5), Mac-1 (M1-70), NK1.1 (PK136), Thy1.2 (53-2.1), ^jyD#
CD45R–B220 (RA3-6B2), IgM (R6-60.2), BrdU (3D4) and Ter119 (Ly-76; all from O4|2|sA
Pharmingen). For immunoblot analyses, antibodies to the following were used: RhoH9 2<r\/-#pU
(B4998), Zap70 phosphorylated at Y319 (17a), phosphorylated tyrosine (4G10) and Lat -x]`DQUg
(45; Pharmingen); hemagglutinin (3F10; Roche); -actin (AC-15; Sigma); CD3 pIO4,VL;W
(6B10.2; Santa Cruz Biotechnology); and Lat phosphorylated at Y191 (3584), Zap70 !Q%P
%P<$
(99F2), phosphorylated p42-p44 (Thr202-Tyr204; 197G2) and p42-p44 (9102; Cell 0(\+-<
Signaling Technology). Primary antibodies were detected with the secondary antibodies pv# 2]v
horseradish peroxidase–conjugated goat anti-mouse (7076) or goat anti-rabbit (7074; both gv.6h{Ut
Cell Signaling Technology), or donkey anti-rat (sc-2956; Santa Cruz Biotechnology) YA&`&$
using enhanced chemiluminescence detection (Cell Signaling Technology). GST fusion ^[q /Mw
proteins were expressed in Escherichia coli BL21 (DE3) cells and were purified RFfIF]~3
according to the manufacturer's recommendations (GE Healthcare Life Science). Purified 7$uJ7`e
GST fusion protein lysates were incubated for 1 h at 4 °C with glutathione–Sepharose 4B Hfc"L>
beads. Bead-bound GST fusion proteins were separated by SDS-PAGE and were JK )qZ=
quantified by Coomassie blue staining. ]r/^9XaqtA
GST precipitation assay. -Zc![cAlO
Jurkat cells were lysed in GST lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 !a-b6Aa
mM MgCl2, 1% Nonidet-P40 and Complete Protease Inhibitors). Cell lysates were loaded |m*.LTO
onto columns of bead-bound GST fusion proteins. After columns were washed with GST WlVl[/qt
lysis buffer containing 150 mM and 200 mM NaCl, bound proteins were eluted with GST %J7UP4
lysis buffer containing 400 mM NaCl and SDS sample buffer, sequentially. Eluted (Tvcq
proteins were detected by SDS-PAGE and Coomassie blue staining. Protein bands were WZewPn>#q
identified with a Bruker Biflex III MALDI-TOF mass spectrometer (SpectroREADER; M]rO;^ ;6?
Sequenom) and Protein Mass Fingerprinting Mascot search (Matrix Science). _GA$6#]
Subcellular fractionation. m5c&&v6%"b
Cells were lysed by brief sonication on ice in a buffer of 250 mM sucrose, 20 mM Tris, 0Y+FRB]u
pH 7.8, 10 mM MgCl2, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF and Complete F:g= i}7
Protease Inhibitors. Lysates were centrifuged to remove nuclei and debris (900g for 5 min m,MSMw1p
at 4 °C). The P100 and S100 fractions were separated by centrifugation for 30 min at ~^U
S/"
100,000g. Membrane fractions were made soluble with MLB (Upstate) plus protease and `:|@Zln
phosphatase inhibitors. After centrifugation for additional 30 min at 100,000g, the k4\UK#ODe
detergent-insoluble cytoskeleton-containing fraction was resolved by 0.5% SDS-PAGE. 4,P
bg|
Assessment of Intracellular Calcium Concentration L36Yx7gT<