加入VIP 上传考博资料 您的流量 增加流量 考博报班 每日签到
   
主题 : 医学SCI 论文经典句子汇编
级别: 中级博友
显示用户信息 
楼主  发表于: 2009-10-18   

医学SCI 论文经典句子汇编

Title pq<302uBQ  
要求简练,精确 V\C$/8v  
Compassionate use of bevacizumab (Avastin) in children and young adults with ?Q`u\G3.m  
refractory or recurrent solid tumors. "RZV v~BD  
Bevacizumab-induced transient remodeling of the vasculature in neuroblastoma 5W UM"eBwL  
xenografts results in improved delivery and efficacy of systemically administered ;QVX'?  
chemotherapy. irg% n  
Proteomics Approaches to the Systems Biology of Cardiovascular Diseases <{ Z$!]i1  
Pre- and post-natal treatment of hemophagocytic lymphohistiocytosis. Oy> V/  
Lack of early bevacizumab-related skeletal radiographic changes in children with W{z7h[?5,  
neuroblastoma. Sb9O#$89  
Interleukin-4 activates androgen receptor through CBP/p300 #q[k"x=c  
Trisomy 8 in an allogeneic stem cell transplant recipient representative of a *U[Nn5#?  
donor-derived constitutional abnormality. v61'fQ1Qg!  
Disruption of diacylglycerol metabolism impairs the induction of T cell anergy 3_AVJv ;N  
T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase- hB]\vA7  
High-dose conformal RT improves tumor control in patients with prostate cancer *G]zN"Y  
Vitamin D concentration does not affect the risk of prostate cancer  4[\[Ho  
Liver resection with salvage transplantation for hepatocellular carcinoma ynWF Y<VX  
The impact of histopathologic diagnosis on the proper management of testis neoplasms /hNZ7\|P  
Prostate stem cell antigen is associated with diffuse-type gastric cancer jB"?iC.  
Multiple myeloma: high-risk immunophenotypes identified 2swHJ.d\  
Increased c-kit expression predicts poor outcome in acute myeloid leukemia H <gC{:S  
Global Analysis of the Meiotic Crossover Landscape p2(U'x c  
Serum Response Factor Is Required for Sprouting Angiogenesis and Vascular Integrity nPAVrDg O  
Integrin Trafficking Regulated by Rab21 Is Necessary for Cytokinesis dIQxU  
Reduced Translocation of Nascent Prion Protein During ER Stress Contributes to y;M}I8W[  
Neurodegeneration f{m,?[1C,  
Effects of oral niacin on endothelial dysfunction in patients with coronary artery disease: ?9F_E+!  
Results of the randomized, double-blind, placebo-controlled INEF study. C(RZ09,.S  
Global experiences with vardenafil in men with erectile dysfunction and underlying sYt\3/yL'  
conditions. "s:eH"_s  
2 dtXA EL\q  
Noninvasive cardiac imaging: implications for risk assessment in adolescents and young Z= 'DV1A$,  
adults.  k|Xxr  
Transforming growth factor beta1 T29C gene polymorphism and hypertension: X {[" 4  
Relationship with cardiovascular and renal damage. t[L_n m5-  
A comparison of hormone therapies on the urinary excretion of prostacyclin and eU[f6OGqC  
thromboxane A2. 7W{xK'|]  
Repair of an infected aortic aneurysm using an aortic allograft and a venous autograft: /b$0).fj@,  
Report of a case. [<2#C#P:6  
Circulating Leptin and Stress-induced Cardiovascular Activity in Humans. xK8n~.T('  
Effects of aspirin dose on ischaemic events and bleeding after percutaneous coronary j@j%)CCM  
intervention: insights from the PCI-CURE study. mnZS](>  
Long-term cardiovascular outcomes following ischemic heart disease in patients with and y<53xZi  
without peripheral vascular disease. a\UhOPFF  
Reduced renal function and sleep-disordered breathing in community-dwelling elderly GzC=xXON  
men. )ZyEn%  
Intracoronary pharmacotherapy in the management of coronary microvascular w2 L'j9  
dysfunction. i?*_-NAm  
Inhibition of platelet aggregation by combined therapy with aspirin and cilostazol after Oq7R^t`b  
off-pump coronary artery bypass surgery. tt|v opz  
Inhibition of CCR2 Ameliorates Insulin Resistance and Hepatic Steatosis in db/db Mice c`hj^t  
Abstract 要求简洁,连贯 fn!(cE|`E  
The acquisition of metastatic ability by tumor cells is considered a late event in the @,Re<%\  
evolution of malignant tumors. We report that untransformed mouse mammary cells that -w0U }Te^  
have been engineered to express the inducible oncogenic transgenes MYC and KrasD12, or mt0ZD}E  
polyoma middle T, and introduced into the systemic circulation of a mouse can bypass g^CAT1}  
transformation at the primary site and develop into metastatic pulmonary lesions upon !<ae~#]3 P  
immediate or delayed oncogene induction. Therefore, previously untransformed Z[(V0/[]  
mammary cells may establish residence in the lung once they have entered the d%"?^ e  
bloodstream and may assume malignant growth upon oncogene activation. Mammary qtx5N)J6  
cells lacking oncogenic transgenes displayed a similar capacity for long-term residence in U%Igj:%?;`  
the lungs but did not form ectopic tumors. _n[4+S*v(  
Almost two decades after CFTR was identified as the gene responsible for cystic fibrosis Ar+<n 2;[  
(CF), we still lack answers to many questions about the pathogenesis of the disease, and it ,%|$# g 0  
remains incurable. Mice with a disrupted CFTR gene have greatly facilitated CF studies, L$ nFRl&  
but the mutant mice do not develop the characteristic manifestations of human CF, ^G(/;c*=  
including abnormalities of the pancreas, lung, intestine, liver, and other organs. Because #WOb&h  
pigs share many anatomical and physiological features with humans, we generated pigs jq4'=L$4  
with a targeted disruption of both CFTR alleles. Newborn pigs lacking CFTR exhibited ]^>#?yEA3  
defective chloride transport and developed meconium ileus, exocrine pancreatic D92#&,KD  
destruction, and focal biliary cirrhosis, replicating abnormalities seen in newborn humans F$Cf\#{3  
3  Tl.%7)  
with CF. The pig model may provide opportunities to address persistent questions about wU\3"!^h  
CF pathogenesis and accelerate discovery of strategies for prevention and treatment. SqiLp!Y`  
Variable lymphocyte receptors (VLRs) rather than antibodies play the primary role in wbC'SOM  
recognition of antigens in the adaptive immune system of jawless vertebrates. 0@ -3U{Q  
Combinatorial assembly of leucine-rich repeat (LRR) gene segments achieves the  IX|2 yu4  
required repertoire for antigen recognition. We have determined a crystal structure for a vFKt=o$ g  
VLR-antigen complex, VLR RBC36 in complex with the H-antigen trisaccharide from ng ZkBX  
human blood type O erythrocytes, at 1.67 angstrom resolution. RBC36 binds the lS`hJ:  
H-trisaccharide on the concave surface of the LRR modules of the solenoid structure R!v ?d2  
where three key hydrophilic residues, multiple van der Waals interactions, and the highly (z[|\6O  
variable insert of the carboxyl-terminal LRR module determine antigen recognition and -PHVM=:  
specificity. The concave surface assembled from the most highly variable regions of the H:~41f[  
LRRs, along with diversity in the sequence and length of the highly variable insert, can Cq7EdK;x  
account for the recognition of diverse antigens by VLRs. =w~phn  
A 51-year-old man with a diagnosis of myelodysplasia and non-Hodgkin's lymphoma t=`bXBX1  
underwent an unmatched allogenic bone marrow transplantation and was treated !wws9   
posttransplant with chronic immunosuppressive medication. Eight months following va(ZGGS]N  
transplantation, he presented with progressive dysarthria, cognitive and visual decline. ;tS4 h  
Evaluation included brain magnetic resonance (MR) imaging demonstrating multifocal Wr\rruH6  
areas of increased T2 and FLAIR (fluid attenuated inversion recovery) signals involving x5Sc+5?*  
the left frontal, parietal, and occipital lobes. The MR lesions demonstrated diffuse erG;M!9\  
increased signal on DWI (diffusion-weighted images) and normal to low signal on ADC );LkEXC_'  
(apparent diffusion coefficients). Contrast-enhanced T1 images were unremarkable. UMg*Yv%  
Lumbar puncture revealed a mild elevation in cerebrospinal fluid (CSF) protein. CSF -{ Ng6ntS  
PCR assay for viral DNA fragments were negative on two occasions. Serum serology for 49o5"M(  
HIV was negative as well. A brain biopsy was subsequently performed. The clinical and -U6" Ce  
neuroimaging differential diagnoses as well as neuropathologic correlation are presented. QyJ2P{z  
In vitro-generated mesenchymal stem cells (MSCs) initially attracted interest for their axTvA(k9  
ability to undergo differentiation toward cells of different lineages. & yKUf  
These results suggested that a@&^t(1  
However, there are still obstacles in ,0^:q)_  
The major challenge for successful drug development is identifying delivery strategies _,h hO  
that can be translated to the clinic. g-c\ ;  
This review will discuss progress in developing and testing small RNAi-based drugs and )V!dmVQq{g  
potential obstacles. :y)'_p *l/  
This review highlights what :les 3T}2  
In addition, there are indications that p]d3F^*i  
Proper consideration of all of these issues will be necessary in 7o$4ov;T  
These studies provide G S^U6Xef  
This paper presents the potential applications and the hurdles facing anti-HCV siRNA !]tZE%?  
drugs. wo;`D  
The present review provides insight into the feasible therapeutic strategies of siRNA 8$fiq}a  
technology, and its potential for silencing genes associated with HCV disease. .P[ %t=W  
4 p[*NekE6-  
A basic problem in the design of xx is presented by the choice of a xx rate for the DkP%1Crdr  
measurement of experimental variables. 1mw<$'pm0  
This paper examines a new measure of xx in xx based on fuzzy mathematics which lY5a=mwHU  
overcomes the difficulties found in other xx measures. { 1^9*  
This paper describes a system for the analysis of the xx. s)q;{wz  
The method involves the construction of xx from fuzzy relations. {`0GAW)q  
The procedure is useful in analyzing how groups reach a decision. xF*C0B;QL  
The technique used is to employ a newly developed and versatile xx algorithms. m/"\+Hv  
The usefulness of xx is also considered. Gc) Zu`67  
A brief methodology used in xx is discussed. eATX8`W  
The analysis is useful in xx and xx problem. g)+45w*+5  
A model is developed for a xx analysis using fuzzy matrices. v4}kmH1  
Algorithms to combine these estimates and produce a xx are presented and justified. ]XEkQ  
The use of the method is discussed and an example is given. _DChNX   
Results of an experimental applications of this xx analysis procedure are given to ,*fvA?  
illustrate the proposed technique. "M*Pt  
This paper analyses problems in ^Bihm] Aq  
This paper outlines the functions carried out by ... S8+Xk= x  
This paper includes an illustration of the ... ;b:Ct<  
This paper provides an overview and information useful for approaching JHN3 5a+  
Emphasis is placed on the construction of a criterion function by which the xx in ^'DrU< o  
achieving a hierarchical system of objectives are evaluated. yi3@-   
The main emphasis is placed on the problem of xx K;2tY+I  
Our proposed model is verified through experimental study. q2}<n 'o+  
The experimental results reveal interesting examples of fuzzy phases of : xx,xx K#g)t/SZ  
The compatibility of a project in terms of cost, and xx are likewise represented by x\j6=|  
linguistic variables. e.eQZ5n~q`  
A didactic example is included to illustrate the computational procedure vv,OBL~{  
Introduction 引证核心文献,提出假设,指出文章的核心观点 *7hr3x  
Beginning %p?u ^rq  
Over the course of the past 30 years, .. has emerged form intuitive b'fj  
We evaluated 508 participants who eRllF` *  
Acute kidney injury (AKI) is associated with an increased incidence of respiratory failure 8cy#[{u`;  
requiring mechanical ventilation, which greatly increases mortality hQrO8T?2  
The cause of respiratory failure in patients with AKI is incompletely understood 5EDM?G  
However, lung injury also occurs after ischemia–reperfusion injury of other organs such JZ&]"12]fR  
as the liver, gut, and hind limb `zAo IQ  
We have demonstrated previously that ]* -9zo0  
Given this background, we hypothesized that = wNul"  
we demonstrate that @= )_PG  
Technological revolutions have recently hit the industrial world S~`& K  
The advent of ... systems for has had a significant impact on the V 0R;q  
5 Kx6_Vp  
The development of ... is explored X\\WQxj  
The concept of xx was investigated quite intensively in recent years =!r9;L,?  
There has been a turning point in ... methodology in accordance with the advent of ... +\9Y;N y  
A major concern in ... today is to continue to improve... nK Rx_D$d  
It has become increasingly clear that >:5/V0;,  
In this paper, we focus on the need for N. 3 x[%:  
This paper proceeds as follow. ptGM'  
The structure of the paper is as follows. Q~]#x![u0  
Our study l"!.aIY"e  
In this paper, we shall first briefly introduce… HKx2QFB  
To begin with we will provide a brief background on the YVZm^@ZVV  
This will be followed by a description of the xx of the problem and a detailed 6Km@A M]  
presentation of how the required membership functions are defined. dk J+*L5  
Details on xx and xx are discussed in later sections. I(ds]E ;_E  
Polyphenolic compounds are vasodilators and help to lower the risk of cardiovascular <9YRSE [Ed  
diseases. hf>JW[>Xo  
Taken together, our novel findings suggest that the EDR induced by the strawberry @v _ )(  
extract was mediated by activation of the PI3 kinase/Akt signaling pathway, resulting in %0@Jm)K^  
phosphorylation of eNOS. ( du<0J|PT  
Objective / Goal / Purpose gO4` e(W  
The purpose of the inference engine can be outlined as follows: i3s-l8\\z  
The ultimate goal of the xx system is to allow the non;experts to utilize the existing rC}r99Pe:x  
knowledge in the area of manual handling of loads, and to provide intelligent, +j&4[;8P:  
computer;aided instruction for xxx. v! uD]}  
The paper concerns the development of a xx Hn0 ,LH$/  
The scope of this research lies in WMZ&LlB%  
The main theme of the paper is the application of rule;based decision making. N|?"=4Z?  
These objectives are to be met with such thoroughness and confidence as to permit ... j%Y`2Ra  
The objectives of the ... operations study are as follows: #, W7N_mt  
The primary purpose/consideration/objective of 3D[IZ^%VtM  
The ultimate goal of this concept is to provide C4&yC81Gm  
The main objective of such a ... system is to 0sto9n3  
The aim of this paper is to provide methods to construct such probability distribution. :84fd\It4  
In order to achieve these objectives, an xx must meet the following requirements: _n@#Lufx  
In order to take advantage of their similarity /=A^@&:_#  
more research is still required before final goal of ... can be completed R8Nr3M9 )  
In this trial, the objective is to generate... BV" 7Wp;  
for the sake of concentrating on ... research issues z{Z'2, #  
A major goal of this report is to extend the utilization of a recently developed procedure '@i/?rNi%N  
for the xx. rg)>ZHx  
For an illustrative purpose, four well;known OR problems are studied in presence of ,1EyT>  
fuzzy data: xx. Eb{Zm<TP  
6 xCz(qR  
This illustration points out the need to specify C,Q>OkSc  
Recent studies have further defined the role of SBP-2 in promoting UGA read-through, xDG8C39qrs  
This concept has been further validated with the discovery of patients with impaired b/HhGA0  
deiodinase activity due to a mutation in SBP-2 URdCV{@42  
The ultimate goal is both descriptive and prescriptive. *,q ?mO  
A wealth of information is to be found in the statistics literature, for example, regarding +KgLe>-}  
xx nh"nSBRxk  
This review will focus on the most recent progress achieved in this field, particularly the "bZ%1)+  
cellular and molecular aspects of local control of thyroid hormone signaling provided by K?o( zh;  
deiodinases. 0+%{1JkJq  
A considerable amount of research has been done .. during the last decade *UhYX)J  
A great number of studies report on the treatment of uncertainties associated with xx. ;NQ9A &$)  
There is considerable amount of literature on planning b6Pi:!4  
However, these studies do not provide much attention to undertainty in xx. 2kb<;Eh`G  
Since then, the subject has been extensively explored and it is still under investigation as 8Yc'4v#}  
well in methodological aspects as in concrete applications. hAX@|G.  
Many research studies have been carried out on this topic. s :ig;zb  
Problem of xx draw recently more and more attention of system analysis.  B C*62m  
Attempts to resolve this dilemma have resulted in the development of uNSaw['0j  
Many complex processes unfortunately, do not yield to this design procedure and have, pW$ZcnU  
therefore, not yet been automated. F|pM$Kd`  
Most of the methods developed so far are deterministic and /or probabilistic in nature. |`vwykhezO  
The central issue in all these studies is to >L[n4x\  
The problem of xx has been studied by other investigators, however, these studies have n'*4zxAA  
been based upon classical statistical approaches. ehCGu( =  
Applied ... techniques to Nc;cb  
Characterized the ... system as San3^uX   
Developed an algorithm to X)7_@,7  
Developed a system called ... which :Y wb  
Uses an iterative algorithm to deduce w]L^)_'Th  
Emphasized the need to =D-u".{  
Identifies six key issues surrounding high technology "y~tAg  
A comprehensive study of the .. has been undertaken wr);+.T9R  
Much work has been reported recently in these filed oVlh4"y#Lf  
Proposed PgOOFRwP  
Presented 0b=1Ce+0q  
State that xf2|9Tqt  
Point out that the problem of RW"QUT  
Described 4# +i\H`  
Illustrated 9-:\ NH^;  
Indicated /=5:@  
Has shown / showed }ejZk bP  
Address $'*q]]  
7 +/+>:  
Highlights a gk w)#  
A study on ...was done / developed by [] L2\<iJA}c  
Previous work, such as [] and [], deal only with q4MR9ig1E_  
The approach taken by [] is jouA ]E  
The system developed by [] consists >U\1*F,Om,  
A paper relevant to this research was published by [] ) kMF~S|H  
[]'s model requires consideration of .. X+2uM+  
[]' model draws attention to evolution in human development C))x#P36  
[]'s model focuses on... 6 2:FlW>  
Little research has been conducted in applying ... to s$gR;su)g  
The published information that is relevant to this research... ?lca#@f(  
This study further shows that U9"( jl/o  
Their work is based on the principle of *fCmZ$U:{  
More history of ... can be found in xx et al. [1979]. {8* d{0l  
Studies have been completed to established gNHS:k\"  
The ...studies indicated that oRZ98?Y\B  
Though application of xx in the filed of xx has proliferated in recent years, effort in j:2TicHD C  
analyzing xx, especially xx, is lacking. $GR rTC!  
提出Problem / Issue / Question 或假设 X5pb9zRq  
Unfortunately, real-world engineering problems such as manufacturing planning do not p'`?CJq8  
fit well with this narrowly defined model. They tend to span broad activities and require lqTc6@:D  
consideration of multiple aspects. \,xa_zeO  
Remedy / solve / alleviate these problems D7r&z?  
It has recently been reported that [ $5u:*  
... is a difficult problem, yet to be adequately resolved c)3.AgT  
Two major problems have yet to be addressed n:[@#xs-  
An unanswered question {/j gB"9  
This problem in essence involves using x to obtain a solution. P;`Awp?  
An additional research issue to be tackled is .... -UM|u_  
Some important issues in developing a ... system are discussed k Nvb>v  
The three prime issues can be summarized: %VGW]!QR  
The situation leads to the problem of how to determine the ... Lf)JO|o  
There have been many attempts to -2[#1S*  
It is expected to be serious barrier to ?[uHRBR'  
It offers a simple solution in a limited domain for a complex problem. !1Hs;K  
There are several ways to get around this problem. DaQ+XUH?  
As difficult as it seems to be, xx is by no means new. Fge ["p?GF  
The problem is to recognize xx from a design representation. >8ryA$  
A xx problem can trace its roots to xx. xG;;ykh.]  
xx [1987] used a heuristic approach to simplify the complexity of the problem. 2F+"v?n=\  
Several problems are associated with them. =;4K5l{c  
Although some progress has been made in this area, at least two major obstacles must be vV xw*\`<6  
overcome before a fully automated system can be realized. r.'xqzF/  
Most problems in practice are complicated ; Xf1BG r  
More problem surface here. O,Tp,w T  
Hamper effort toward a xx system ?e m8nZ'  
In order to overcome the limitations due to incomplete and imprecise xx knowledge, a xx -wrVEH8  
program has been developed, which bases its knowledge upon the statistical analysis of a q 'd]  
sample population of xx MhR`  
The above difficulties are real challenges faced by researchers attempting to develop F b?^+V]9  
This type of mapping raises no controversy to the issue of membership function 4/%fpU2  
determination. >|c?ZqW  
However, attempts to quantify the xx have met both theoretical and empirical problems. z"T+J?V/  
It has become apparent that in order to apply this new methodological framework to n807?FORB  
real;world problems and data, we have to pay attention to the problems of xx and xx. PJ; WNo8  
MATERIALS AND METHODS =^GPQ _"  
Materials P JATRJ1.  
Chemicals were purchased from Sigma (St Louis, MO), if not stated otherwise. Y<|JhqOXK  
Experiments were conducted in accordance with the NIH Guidelines for the Care and Use :{N*Z}]  
of Laboratory Animals. Yb^e7Eug  
CsA, EGF, PD98059, U0126, AG1478, Wortmannin, and LY294002 were from p:TE##  
Calbiochem (San Diego, CA, USA). Anti-ERK1/2 and anti-Ras were from Transduction 9DJ&J{2W  
Laboratories (Franklin Lakes, NJ, USA). Anti-phospho Raf-1 (Ser259), anti-phospho }2@Z{5sh)  
Raf-1 (Ser338), anti-phospho PKB/Akt (Ser473), anti-PKB, anti-phospho EGFR (Tyr1068), MOK}:^bSu  
anti-phospho ERK1/2 (Thr202/Tyr204), anti-PI3K 110 , anti-p53, and anti-phospho u. |%@  
MEK1/2 (Ser217/221) were from Cell Signalling (Danvers, MA, USA). Anti-MEK and YTFU# F  
anti-Raf-1 (C12) were from Santa Cruz (Santa cruz, CA, USA). Apigenin and all other jan}}7Dly  
reagents were from Sigma (Saint Louis, MO, USA). lHtywZ@%3  
Animal < #ON  
Eight- to ten-week-old male C57BL/6 mice (wild-type) and IL-6-deficient mice ij!d-eM/b  
backcrossed over eight generations on a C57BL/6 background were used i_Hm?Bi!F  
Mice were maintained on a standard diet and water was made freely available. J/'Fj?  
All experiments were conducted with adherence to the NIH Guide for the Care and Use }< H>9iJ:  
of Laboratory Animals. Bkd$'7UT  
The animal protocol was approved by the Animal Care and Use Committee of the 6`O,mpPu4G  
University of Colorado L&DjNu`!9  
Three surgical procedures were performed as described previously:5 (1) sham operation, iq*im$9 J  
(2) ischemic AKI, and (3) bilateral nephrectomy. wYf\!]}'  
The abdomen was closed in one layer. _]OY[&R  
Sham surgery consisted of the same procedure except that clamps were not applied. tO{{ci$-T  
9 g5@JA^\vZT  
For bilateral nephrectomy, renal pedicles were tied off with suture and then cut distally. KR#,6  
The ureters were pinched off with forceps and the kidneys removed. RbL?(  
Serum was collected as described previously.5 Blood urea nitrogen and creatinine were @KK6JyOTQ  
measured using an autoanalyzer (Beckman Instruments, Fullerton, CA, USA). v']_)  
Serum IL-6 was measured by ELISA according to assay instructions (R&D Systems, ySr,HXz  
Minneapolis, MN, USA). >^~^#MT  
Five-micrometer sections of paraffin-embedded lung tissue were stained with wx*?@f>u^  
hematoxylin and eosin using standard protocols. Neutrophils were counted on the basis of H[u9C:}9b  
morphological criteria; at least 50 high-powered fields ( 40) were counted per slide. `Y:]&w  
Frozen lung was prepared for ELISA as described previously.5 Supernatants were (M$0'BV0  
analyzed for protein content using a Bio-Rad DC protein assay kit (Hercules, CA, USA). Ob/)f)!!  
KC and MIP-2 were determined by ELISA (R&D Systems, Minneapolis, MN, USA). ).^d3Kp  
One-fourth lung was used to determine MPO activity as described previously. oj djy#:  
Frozen lung was homogenized in radioimmunoprecipitation assay buffer with protease YbU8 xq  
inhibitor; western blotting was performed as described previously.49 Goat anti-murine M YF ^zheD  
ICAM-1 polyclonal antibody (R&D Systems, Minneapolis, MN, USA; 1:2000) or rat #"4ioTL2  
anti-murine VCAM-1 monoclonal antibody (R&D Systems; 1:1000) were used. #@B"E2F  
A total of 20 g anti-IL-6 antibody vs IgG control (eBioscience, San Diego, CA, USA) D!~ Y"4<  
was administered to wild-type mice by tail vein injection 1 h before surgery, oIE 1j?  
intraperitoneally at the time of clamp removal (ischemic AKI) or nephrectomy (bilateral 3[ [oAp  
nephrectomy) and intraperitoneally 1 h following surgery (60 g total). J _O5^=BP  
Experimental groups [Kwj 7q`  
STZ-induced diabetic rats, a model of partial type I diabetes: SD rats received a single %*gf_GeM  
intraperitoneal injection of freshly prepared STZ (65 mg kg-1 body weight, dissolved in 'Tm1Mh0Fso  
100 mmol l-1 citric acid, pH 4.5), and confirmed 2 days later by PP blood glucose ~A=zjkm  
(>250 mg dl-1). 2|>\A.I|=  
CTR rats: Vehicle-injected SD rats after 2 to 7 days, 14 to 30 days, and 90 days served as =IC.FT}  
CTR for the 2 and 7 days STZ, the 14 and 30 days STZ, and for the 90 days STZ, BX?DI-o^h  
respectively. T'5{p  
Insulin treatment in STZ: Glc was normalized in seven animals during 12–14 days of G\gjCp?!  
STZ by subcutaneous insulin implants (2U day-1; Lin Shin Canada, Ontario, Canada). Bu(51wU8  
Cell Culture P1mg;!tq  
Immortalized cells from the convoluted portion of mouse kidney proximal tubule OBAO(Ke  
PKSV-PCT cells (PCT3 clone) were cultured in a medium A (DMEM/Ham's F12 (1:1, J9mK9{#q  
v/v), 20 mM HEPES, 2 mM L-glutamine, 12.5 mM D-glucose, 60 nM sodium selenite, StI N+S@Z  
5 g ml-1 transferrin, 50 nM dexamethasone, 100 U ml-1 penicillin, and 100 g ml-1 (GmBv  
streptomycin), supplemented with 2% fetal bovine serum, 5 g ml-1 insulin, 10 ng ml-1 #|b*l/t8  
EGF, and 1 nM triiodothyronine at 37°C in a 95:5 air/CO2 water-saturated atmosphere. )s $]+HQs  
For all experiments, cells were seeded at 0.2 106 cells/ml and after 24 h with complete cdMSC7l!  
medium cells were starved for 16 h in medium A supplemented with 0.1% fetal bovine eg;7BZi m{  
10 E'LI0fr  
serum but not insulin, EGF, or triiodothyronine. CsA was dissolved in ethanol and all the #%E`~&[  
pharmacological inhibitors were in DMSO. In all cases, controls were carried out with [9"> }l  
cells treated with the corresponding vehicle alone. After treatments, cells were washed 4eHSAN "$  
twice with cold phosphate-buffered saline (PBS) and harvested with lysis buffer as in RAO+<m  
Llorens et al *igmi9A  
Cell viability ?J:w,,4m  
After treatments, PCT3 cells were harvested and washed twice with cold PBS, and the v+nXKNL  
viable cells were counted with Trypan Blue Dye (Gibco-Life Technologies, Grand Island, A%8 Q}s$<s  
NY, USA) in a Neubauer chamber. Living cells exclude the dye, whereas dead cells will 0/Q_% :  
take up the blue dye. For Hoechst staining, cells seeded in six-well dishes were washed =<n ]T;  
twice with PBS and fixed for 15 min with 4% paraformaldehyde at room temperature. g Q\.|'%  
Then, cells were washed twice again with PBS and stained with Hoescht (5 g ml-1 in o,rF15  
PBS) for 5 min. W>pe-  
Western blots/ Immunoblot &nm Bsl3Q.  
The protein content of cellular extracts was quantified by the Bradford assay.44 \}b2 oiY  
Twenty-five microgram of total cell extract protein was run on SDS-polyacrylamide gel Orq/38:4G  
electrophoresis gels, transferred onto polyvinylidene difluoride membranes, and ^)dsi  
incubated with the corresponding antibodies. The membranes were developed with the S\:^#Yi`  
enhanced chemiluminescence method (Pierce, Rockford, IL, USA). bg zd($)u  
Supernatants of growing or growth-arrested cells were centrifugated for 5 min at 10 000 g. lM\dK)p21O  
The cells were lysed as described. The proteins from supernatant and cell lysates were &hWELZe0vv  
concentrated using heparin sepharose. The heparin sepharose was washed four times with iE'_x$i  
phosphate-buffered saline containing protease inhibitors, dissolved in phosphate-buffered eHgr"f*7   
saline/protease inhibitor and incubated with 500 g protein over night at 4°C. The { I{ 0rV  
complexes were washed with phosphate-buffered saline/protease inhibitor and the Dge#e  
proteins were eluated with 100 l Laemmli buffer without bromophenol blue (10 min 5=TgOS]R  
95°C). A 30 l probe was loaded in each lane and western blot analysis was performed as N?@^BZ  
described, using a polyclonal antibody against CCN3 (K19M), which recognizes a 7\UHADr  
C-terminal 19-aminoacid peptide of human CCN3. As a positive control, a supernatant [E9iuym  
from adrenocortical cell cultures, which are known to secrete CCN3, was used. v^&HZk= (  
Cells were lysed in 0.5% (volume/volume) Triton X-100 lysis buffer and immunoblot \:m~ +o$<-  
analysis was done as described43. Immunoprecipitation with anti-CrkL or control rabbit d*6f,z2=  
antiserum was done as described44. Antibodies to the following were used: &;$uU  
phosphorylated Erk (910L; Cell Signaling); phosphorylated Jnk (V7932; Promega); Erk Nn_fhc>  
(13-6200; Zymed); Jnk1 (sc-474), H-Ras (sc-35), C3G (sc-869), CrkL (sc-319), B!&5*f}*  
RasGRP1 (sc-8430) and DGK- (sc-8722; all from Santa Cruz Biotechnologies); and 2c Xae  
DGK- (a gift from H. Kanoh, Sapporo Medical University, Sapporo, Japan). Images vsI;ooR>  
were scanned, followed by densitometry analysis with UN-SCAN-IT software (Silk :%gc Sm  
Scientific). (U 'n1s/X  
11 <Y)14w%  
Purified splenic T cells were stimulated for various times with 5 g/ml of anti-CD3 nFni1cCD  
(500A2; BD Pharmingen) and were lysed in 1% Nonidet P-40 lysis buffer (1%  hlVC+%8  
(volume/volume) Nonidet-40, 150 mM NaCl and 50 mM Tris, pH 7.4) with protease ?w/p 9j#  
inhibitors. Proteins were resolved by SDS-PAGE and were transferred to a Trans-Blot 1:eWZ]B5"  
Nitrocellulose membrane (Bio-Rad Laboratories); membranes were probed with [],[LkS  
antibodies specific to phosphorylated Erk (91015; Cell Signal Technology) and CAc]SxLh  
phospholipase C- 1 (05-163; Upstate Biotechnology). Membranes were stripped and X0j\nXk  
were reprobed for analysis of total Erk (SC-16982; Santa Cruz Biotechnology). Activated x)?V{YAL  
Ras in cell lysates was determined by glutathione S-transferase–Raf—Ras-binding 0s`6d ;  
domain precipitation assay as described gNr4oOR{  
Immunofluorescence microscopy.  C6gSj1  
Analysis of protein localization in 2C T cell–P815.B71 cell conjugates was done as Uv59 XF$  
described29. P815.B71 cells were labeled with CMAC (7-amino-4-chloromethylcoumarin) KLe6V+ki*  
Cell-Tracker Blue (Molecular Probes) and were mixed with equal numbers of anergic or 0-p^o A  
in vitro–primed 2C Rag2-/- T cells. After approximately 8 min, cells were fixed, were m !:F/?B  
made permeable and were stained with anti-GRP1 and anti-talin (Santa Cruz ,q*|R O  
Biotechnologies) and with species-specific secondary antibodies conjugated to 6ud?US(  
fluorescein isothiocyanate or phycoerythrin, respectively. Samples were analyzed with a 3~`\FuHHe  
Zeiss Axiovert 100 microscope, and 15 conjugates were typically assigned scores. dtuCA"D  
Slidebook software (Intelligent Imaging Innovations) was used for image capture and ,GWa3.&.d  
deconvolution analysis. ImageJ 1.36b software (US National Institutes of Health) was 9ZOQNN<ex  
used for quantification of pixel intensity. d i_N}x*  
Measurement of ROS generation 0of:tZU  
The assay is based on the incorporation of 2',7'-dichlorofluorescein diacetate into the cell. ,pcyU\68v  
H2O2 and peroxidases are able to oxidize the cleaved DCFH to DCF, which is highly 0uKm)t/  
fluorescent at 530 nm. To measure CsA-induced ROS generation, cells were washed wPghgjF{  
twice with PBS, and fresh medium containing 20 M 2',7'-dichlorofluorescein diacetate bIT[\Q  
was added to previously treated cells. After 30 min cells were washed again, tripsinized, 5@.8O VPz  
and resuspended with cold PBS. Fluorescence was measure by flow cytometry on a !o' a]8  
FACScan flow cytometer. heF'7ezv#  
Raf-1 activity {(-TWh7V  
Raf-1 immunoprecipitation and kinase assay were performed as described previously.45  :SFf}  
Immunoprecipitated Raf was incubated for 30 min at 30°C with 0.8 mM ATP, 10 g ml-1 }f> 81[^  
GST-MEK, and 100 g ml-1 GST-ERK2. An aliquot of the supernatant was used for f [zKA{R  
ERK2 activity assays using 0.5 mg ml-1 myelin basic protein and 0.1 mM [ -32P] ATP j.Y!E<e4]  
(400 c.p.m. pmol-1). After 15 min incubation at 30°C, 12 l of 5 Laemmli loading 1|*%  
buffer was added to the tubes and the mixture analyzed by SDS-polyacrylamide gel 3 } $9./+  
electrophoresis. Radiolabeled bands were quantified in a PhosphoImager. '( ETXQ@  
12 k;um Lyz  
Semiquantitative RT-PCR. Uwiy@ T Z  
Total RNA was isolated from freshly isolated thymocytes. Then, cDNA was prepared Md:*[]<~  
with the M-MuLV reverse transcriptase and random primers according to the )$Fw<;4  
manufacturer's recommendations (New England Biolabs). Semiquantitative PCR analysis ),;h  
of Tcrb VDJC (where 'C' is the constant region) and Cd3e cDNA was done as described51. Rv*x'w ==  
[32P]dCTP (GE Healthcare Life Science) was incorporated into PCR products for =aT8=ihP  
semiquantitative detection by autoradiography. w2"]%WS%  
Real-time quantitative RT-PCR |b Z 58{}  
Total RNA was isolated from HMC or rat mesangial cells using the Invisorb Spin Ft2 ZZ<As  
Cell-RNA Mini Kit (Invitek, Berlin, Germany) or from isolated glomeruli using the Iq;a!Lya-  
RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA purity determination, cDNA ZCuh ^  
synthesis, and RT-PCR were performed as described.16 Primer sequences are listed in K y7-6$  
Table 2. Glyceraldehyde-3-phosphate dehydrogenase cDNA amplification was used as an ]N'4q}<5o  
internal standard. $>~4RXC  
Total RNA was isolated from the frozen kidneys as described by Chomczynski and T7G{)wm  
Sacchi47 and quantified by a photometer. One microgram of the resulting RNA was used %]DJ-7 xE  
for reverse transcriptase (RT)-PCR. The cDNA was synthesized by MMLV reverse #5kg3OO  
transcriptase (Superscript-Invitrogen, Carlsbad, CA, USA). For quantification of renin jK=-L#hz  
mRNA expression (sense: 5'-ATGAAGGGGGTGTCTGTGGGGTC-3', antisense: $/i;UUd  
5'-ATGCGGGGAGGGTGGGCACCTG-3'), real-time RT-PCR was performed using a fl 9J  
Light Cycler Instrument (Roche Diagnostics Corp., Basel, Suisse) and the QuantiTect W Aw} ?&k  
SYBR Green PCR kit (Qiagen, Hilden, Germany), with GAPDH (sense: ! F&{I  
5'-TTCATTGACCTCAACTACAT-3', antisense: 5'-GAGGGGCCATCCACAGTCTT-3') hzk]kM/OC  
as a control. PCR was run for 30 cycles with 15 s per 95°C denaturation, 20 s/58°C Yv;18j*<  
annealing and 20 s/72°C elongation. To verify the accuracy of the amplicon, a melting Y'LIk Q\  
curve analysis was done after amplification.Total renin mRNA content per kidney was 2ap0/l[  
calculated from the yield of RNA extracted from the whole kidneys times the renin T;I>5aQ:q4  
mRNA estimate obtained from the defined amount of RNA used for RT-PCR real time s2+s1%^Ll  
measurement. For the RT-PCR real-time measurements, a pool of RNA from adult mouse Q_R&+@ju  
kidneys was generated, which served as standard for all RT-PCR runs. Thus, all renin k!,&L$sG  
mRNA levels for the developing kidneys were estimated relative to the levels in adult 4THGHS^  
kidneys. [318Q%W&  
In vitro anergy assay. [^-DFq5@  
Wild-type, Dgka-/- and Dgkz-/- splenocytes were stained with 5 M CFSE, were A0Hsd  
stimulated for 72 h with anti-CD3 (1 g/ml; 2C11) along with CTLA-4–Fc (5 g/ml), Co>=<\yi  
were stained with allophycocyanin-conjugated anti-CD4 and were analyzed by flow SfwAMNCe  
cytometry. Cell division was assessed by CFSE dilution after gating on live CD4+ cells. wg,w;Gle  
Alternatively, cells were stimulated for 72 h and were pulsed with 1 Ci/well of -i?-Xj#%  
[3H]thymidine for the final 8 h of stimulation, and proliferation was assessed by tritium VSt)~  
incorporation with a scintillation counter. For restimulation analyses, cells were ) crhF9!4  
13 '`Z5 .<n7p  
prestimulated with anti-CD3 plus CTLA-4–Fc, then after 72 h, CD4+ cells were purified Dx27s  
by negative selection (with fluorescein isothiocyanate–conjugated anti-CD8, anti-B220 pTJJ.#$CEF  
(RA3-6B2; BD Pharmingen), anti-DX5 and anti-CD11b (M1/70; BD Pharmingen), vJfex,#lv  
followed by depletion with anti–fluorescein isothiocyanate magnetic beads) and were /g!', r,  
allowed to 'rest' overnight at 37 °C. Live cells were then counted by Trypan blue e'zG=  
exclusion, and equivalent numbers of live cells were dropped onto monolayers of bone e[7n`ka '  
marrow–derived macrophages coated with anti-CD3 (1 g/ml) and anti-CD28 (0.5 ~O}LAzGb  
g/ml). After 24 h, supernatants were collected and IL-2 was quantified by ELISA 9q -9UC!g  
according to the manufacturer's protocol (R&D Systems). x-/`c  
Three-dimensional reconstruction AA um1xl  
Serial sections of kidney specimens were fixed and stained for renin and for SMA as Iw$7f kq  
described above. Digitalization of the serial slices was performed using an AxioCam qJN2\e2~f  
MRm camera (Zeiss, Jena, Germany) mounted on an Axiovert200M microscope (Zeiss) &pD6Qq {  
with fluorescence filters for renin and SMA (TRITC: filter set 43: Cy2: filter set 38 HE; ]I#yS=;  
Zeiss). After acquisition, a stack of equal-sized images was built using the graphic tool Hinz6k6!  
ImageJ (Wayne Rasband, NIH, Bethesda, MD, USA). The equalized data were then n LZ  
imported into the Amira 4.1 visualization software (Mercury Computer Systems Inc., T0ebW w  
Chelmsford, MA, USA) on a Dell Precision 690 computer system (Dell, Frankfurt, gI qYIt  
Germany), and subsequently split into the renin and SMA channels. After this step, the X99:/3MXB'  
renin and SMA channels were aligned. In the segmentation step, the SMA and renin Nj_h+=UE!  
data sets served as a scaffold and were spanned manually or automatically using wYJ. F  
grayscale values. Matrixes, volume surfaces, and statistics were generated from these FaC;vuSpy  
segments. ^E8XPK]-~  
Restimulation assay after in vivo immunization. D0D0=s  
For analysis of T cell priming in vivo, CD4+ T cells were collected from naive, primed or eEkF Zx  
tolerized recipient mice on day 15 after immunization. Proliferative responses were I_IDrS)O  
measured by culture for 72 h of CD4+ T cells (3 106 cells/ml) with irradiated (3,000 rads) hGx)X64Mw  
APCs (10 106 cells/ml) and OVA(323–339). The number of KJ1-26+ cells for each `Li3=!V[  
group of recipient mice was determined by flow cytometry and proliferation was aCe<*;b@  
normalized to the number of input KJ1-26+ cells. Supernatants were collected from plates pzP~,cdf  
and cytokine concentrations were measured by ELISA. Cyg\FHs  
Flow cytometry. j^}p'w Tu{  
For analysis of surface antigen expression, mAb to CD4 (JK1.5; eBioscience) and mAb 18pi3i[  
KJ1-26 (KJ-126; Caltag) were used. For intracellular IL-2 staining, T cells were #y"E hwF  
restimulated for 24 h in vitro with OVA(323–339) in the presence of APCs as described b/='M`D}#G  
above. Brefeldin A (eBioscience) was added for the last 6 h of the culture. Cells were n 5X0Gi9  
collected and were stained with allophycocyanin-conjugated mAb to CD4 and fluorescein  g-MaP  
isothiocyanate–conjugated mAb KJ1-26. Then, cells were fixed, were made permeable Iq`:h&'!L  
and were stained with antibody to IL-2 (clone JES6-5H4; eBioscience) according to the ,c#=qb8""  
manufacturer's instructions. Cvr?%+)$M  
14 2XubM+6  
TH1 cells transduced with adenovirus vector encoding GFP were analyzed with a 2B{~ "<  
FACScan (BD Biosciences). A total of 1 104 events were acquired, and data were /(Se:jH$>  
analyzed with CellQuest software (BD Biosciences). wiXdb[[#  
Splenic and lymph node samples depleted of thymocytes and red blood cells were stained y| *X  
with fluorescence-conjugated anti-CD3 (2C11), anti-CD4 (GK15), anti-CD8 (53-6.7), 3>Ts7 wM  
anti-CD25 (7D4) and anti-CD44 (552407; all from BD Pharmingen). A three-color Ly1V@  
FACScan (Becton Dickinson) was used for flow cytometry, and data were analyzed with E(F<shT#  
FlowJo 4.6 (TreeStar). g/&`NlD  
A FACSCalibur (Becton Dickinson) was used for flow cytometry. Human cells from 3VZeUOxY\W  
transplanted NOD-SCID mice were assessed with phycoerythrin–cyanin 5–conjugated XS5*=hv:  
anti–human CD45 and phycoerythrin-conjugated anti-CD19, anti-CD33, anti-CD36 and =l?F_  
anti–glycophorin A (Becton Dickinson). EGFP fluorescence was detected with channel x}t,v.:  
FL1 calibrated to the fluorescein isothiocyanate emission profile. During quadrant 1@*qz\ YY  
analysis, only fluorescence excluding more than 99% of isotypic control events was O`_!G`E  
considered specific. Cell Quest Pro software (Becton Dickinson) and FlowJo (Tree Star) 7/nnl0u8  
were used for data acquisition and analysis. ]RgLTqv4x  
Mammalian expression plasmids and transfection. ]]~tFdh  
For generation of the plasmid expressing Smad3 shRNA, the following specific RO(~c-fV  
oligonucleotides were used: upper, f>\guuG  
5'-GATCCACCTGAGTGAAGATGGAGATTCAAGAGATCTCCATCTTCACTCAGG bjvpYZC\5  
TTTTTTTACGCGTG-3'; lower, -F.A1{l[.  
3'-AATTCACGCGTAAAAAAACCTGAGTGAAGATGGAGATCTCTTGAATCTCCA /,v>w,  
TCTTCACTCAGGTG-5'. These were cloned under control of the U6 promoter into the "L yMw){  
pSIREN-DNR-DsRed expression vector (Clontech, BD). Vector expressing shRNA GRV#f06  
specific for luciferase served as a control. Smad3-Tm was subcloned into the @Sb 86Ee  
pIRES2-EGFP vector (Clontech, BD); empty vector served as a control. Purified ]B'Ac%Rx  
DO11.10 or DO11.10p27 T cells were transfected with plasmids by nucleofection with vK\n4mE[,  
the Amaxa nucleofection apparatus, according to the manufacturer's instructions (Mouse P70\ |M0~y  
T Cell Nucleofector Kit Amaxa Biosytems). Purified T cells were suspended in \LX!n!@  
nucleofector solution (3 106 cells/100 l) and were mixed with 3 g of plasmid. KLqn`m`O;  
Samples were transferred into cuvettes, were transfected with nucleofector program X-01 ].Mr&@  
and were then immediately transferred into 12-well plates and were cultured in *~b3FLzq  
nucleofector medium for 3 h. Then, cells were collected and counted and were Q2[@yRY/z  
immediately transferred into syngeneic recipient mice (3 106 cells per mouse). At 3 h %YjZF[P  
after adoptive transfer, mice were given priming or tolerizing treatment in vivo according '\yp}r'u  
to the standard protocol described above. Lymphocytes were isolated from draining E[N5vG<  
lymph nodes at day 5 of the treatment, CD4+ T cells were purified and transfection 8SmtEV[b3  
efficiency was assessed by flow cytometry. The range of transfection efficiency was #$trC)?~q  
69–75% (Supplementary Fig. 4 online). Smad3-knockdown and control-knockdown fJ"#c<n  
DO11.10 cells and DO11.10 cells transfected with Smad3-Tm and vector control were n^O Wz4  
selected by cell sorting. The resulting CD4+ T cells (2 106 cells/ml) were restimulated HD"Pz}k4  
with OVA(323–339) (5 g/ml) in the presence of irradiated APCs in vitro. O&=40"Dr  
15 pyPS5vWG  
Luciferase assays. c-S_{~~  
CAR IL-2–Luc TH1 clones were transduced with vectors, were stimulated for 20 h and yl63VX8w}  
were resuspended in serum-free DMEM in luminometer cuvettes (BD Biosciences). An Efo,5  
equal volume of Bright-Glo luciferase assay reagent (Promega) was added to each sample, $.Fti-5  
followed by thorough mixing. After 2 min, samples were analyzed with a monolight 2010 =X6+}YQ"  
Luminometer (BD Biosciences). =\v./Q-  
Analysis of cell divisions in vivo. T*"15ppfk  
Purified T cells from DO11.10 and DO11.10p27 mice (10 106 cells/ml) were labeled &=SP"@D  
for 30 min at 37 °C with the intracellular fluorescent dye CFSE (5 M 5(and ![O@{/  
6)-carboxyfluorescein succunimidyl ester; Molecular Probes). Then, cells were washed K*&?+_v :  
twice with cold RPMI 1640 medium containing 10% FCS, were resuspended in PBS and ~r`~I"ZK7^  
were transferred intravenously into BALB/c mice (5 106 cells per mouse). Syngeneic QInow2/u  
hosts were left untreated (naive) or were treated with PBS followed by immunization :Uu Py|>  
with OVA(323–339) (primed) or with CTLA-4–Ig plus mAb to CD40L followed by }NQx2k0  
immunization with OVA(323–339) as described above (tolerized). Then, 3 d later, !6:q#B*  
lymphocytes were isolated from the draining lymph nodes of the BALB/c hosts. The W!a~ #R/r-  
number of cell divisions on CFSE-stained cells and the percentage of cells that had |.D_[QI  
undergone a specific number of divisions were determined as described43. Cells were also :P$I;YY=A  
stained with mAb KJ1-26 and CFSE analysis of KJ1-26+ T cells was done by flow ,6[}qw) *  
cytometry. B"O5P>  
Adenovirus vectors. @a.Y9;O  
The cDNA encoding Ras61L was provided by F. Fitch (University of Chicago, Chicago, [,_M@g3  
Illinois). The dominant negative Cbl construct was generated by RT-PCR with cDNA J90q\_dY.  
from TH1 clones as a template and the following primers (upper case, restriction enzyme \FOX#|i)  
sequences; underlining, Myc tag sequence): /*GRE#7S  
5'-GGGGTACCatggagcagaaactcatctctgaagaggatctggccggcaacgtgaagaaga-3' (forward) and *"E?n>b  
5'-ATAGTTTAGCGGCCGCtcaatcttgaggagttggtt cacataa-3' (reverse). The cDNA mfu >j,7l  
encoding DGK- was a gift from M. Topham (University of Utah, Salt Lake City, Utah) [c?']<f4  
and was used as a template to introduce an N-terminal Myc epitope tag by PCR. The XezO_V  
sequences of all PCR products were confirmed before subcloning. Construction of kmM4KP#&|  
recombinant adenovirus vectors was done with a two-cosmid system that has been b~ ?TDm7  
described42. ki6`d?  
Adenoviral transduction of CAR T cells. OT7F#:2`  
TH1 clones were purified from passage cultures by Ficoll-Hypaque centrifugation. ak50]KYo  
Primary CAR 2C Rag2-/- CD8+ T cells were isolated from splenocytes by negative J WG7QH  
selection with magnetic beads and antibody 'cocktails' (Stem Cell Technologies). CAR ~B%EvG7:n  
TH1 cells were transduced with adenovirus vectors at high cell density (1 107 cells/ml) !l'Az3'J|  
in DMEM containing 2% (volume/volume) FCS and were incubated for 1 h at 37 °C, `$`:PT\Zv4  
16 %+$P<Rw7  
followed by an overnight 'rest' at 37 °C in DMEM containing 5% (volume/volume) FCS ~MY7Ic%  
at low cell density (4 105 cells/ml). &sL5 Pt_  
Lentivirus production and infection protocols. x&R&\}@G m  
A third-generation lentiviral vector encoding EGFP expressed from the human 2]NP7Ee8 Z  
phosphoglycerate kinase promoter was used as described29, 33. Cell populations were @M4~,O6-  
incubated overnight (about 16 h) in X-VIVO-10 medium (BioWhittaker) supplemented 8QYG"CA6/  
with 1% BSA (Stem Cell Technologies) and L-glutamine (Invitrogen) with viral w_^&X;0^  
supernatant (multiplicity of infection of 130–180). Viral concentrations of 1.0 108 to 1.8 c> K/f7  
108 viral particles/ml, 2.0 107 to 4.4 107 viral particles/ml and 0.9 108 to 1.6 108 |aN0|O2  
viral particles/ml and cell concentrations of 0.7 106 to 1.1 106 cells/ml, 1.0 105 to 2.5 ,$3  
105 cells/ml and 0.7 106 to 1.4 106 cells/ml for CD34+CD38lo, CD34+CD38- and Lin- 14\%2nE  
cord blood, respectively, were maintained. The efficiency of gene transfer was estimated S$]:3  
by progenitor cell assay as described33. h_]3L/  
Apoptosis induction. 8BNsh[+  
Spontaneous apoptosis of PMNs was detected after 22 h of incubation in culture media. I(Nsm3L  
In some experiments, zVAD-fmk (10-50 M), TNF (40 ng/ml), resolvin E1–methyl ester, S^)r,cC  
aspirin-triggered lipoxin A4 analog, PD1–methyl ester (10 nM) or TGF- (10 ng/ml) was GMU<$x8o  
added. Vehicle treatment was 0.05% (volume/volume) ethanol. Peripheral blood T cells u7j-uVG  
were activated by incubation for 3 d in 24-well plates coated with anti-CD3 (5 g/ml; 1s\10 hK1c  
R&D Systems). Jurkat cells or activated peripheral blood T cells were incubated for 4–48 q30WUO;  
h with staurosporine (1–2 M) or Fas ligand (0.05–5 ng/ml), after which cells were _DC/`_'  
collected and used for flow cytometry or binding assays. In some experiments, j oDfvY*[  
zVAD-fmk (10–50 M; R&D Systems) was added to cells 20 min before the addition of ^yK94U;<Gy  
apoptosis-indu p{Pa(Z]G  
Mice strains and genotyping. dGIu0\J\$  
The 129/Sv Rhoh-/- mice were generated by Targeting Laboratory. The entire coding uc Z(D|a   
region of mouse Rhoh is in its third exon; the targeting vector was designed to replace the RU"w|Qu>pM  
third exon of Rhoh with a neomycin-resistance cassette. The genotypes of Rhoh $%r|V*5  
gene-targeted embryonic stem cells and transgenic mice were determined by Southern *, *"G?  
blot analysis of DNA digested with SpeI using a 5' Rhoh genomic DNA probe or by PCR ?RpT_u  
analysis with primers. The 129/Sv Rhoh-/- mice were crossed with wild-type or p14 TCR )SA$hwR  
(V 2V 8) transgenic mice on a C57BL/6J background to generate Rhoh-/- or 3jS=  
p14tg/+Rhoh-/- compound mice. Mice used were littermates derived from backcross 7v,>sX  
generations with an N of more than 2. The 129S6/SvEvTac-Rag2-/- mice were purchased iqy}|xAU  
from Taconic Animal Models. All animal experiments were approved by the Institutional 4 >&%-BhN  
Animal Care and Use Committee of the Cincinnati Children's Hospital Research 2zFdKs,  
Foundation (Cincinnati, Ohio). t C6c4j  
Antibodies and GST fusion proteins. !-.-!hBN  
17 _D,8`na>K  
Fluorescence-conjugated monoclonal antibodies to the following mouse antigens were :m&`bq  
used for flow cytometry: CD4 (RM4-5), CD8 (53-6.7), CD25 (7D4), CD44 (IM7), TCR 9Biw!%a  
-chain (H57-597), TCR (GL3), TCR V 8, TCR V 5 (MR9-4), CD69 (H1.2F3), CD5 o B6" D  
(53-7.3), Gr-1 (RB6-8C5), Mac-1 (M1-70), NK1.1 (PK136), Thy1.2 (53-2.1), rB4#}+Uq  
CD45R–B220 (RA3-6B2), IgM (R6-60.2), BrdU (3D4) and Ter119 (Ly-76; all from {t=Nnc15K  
Pharmingen). For immunoblot analyses, antibodies to the following were used: RhoH9 H <1?<1^  
(B4998), Zap70 phosphorylated at Y319 (17a), phosphorylated tyrosine (4G10) and Lat 3$Is==>7  
(45; Pharmingen); hemagglutinin (3F10; Roche); -actin (AC-15; Sigma); CD3 *<Ddn&_  
(6B10.2; Santa Cruz Biotechnology); and Lat phosphorylated at Y191 (3584), Zap70 \Flq8S/t^  
(99F2), phosphorylated p42-p44 (Thr202-Tyr204; 197G2) and p42-p44 (9102; Cell 9d{W/t?NH  
Signaling Technology). Primary antibodies were detected with the secondary antibodies Q%eBm _r;  
horseradish peroxidase–conjugated goat anti-mouse (7076) or goat anti-rabbit (7074; both vj^U F(X  
Cell Signaling Technology), or donkey anti-rat (sc-2956; Santa Cruz Biotechnology) `%ENGB|  
using enhanced chemiluminescence detection (Cell Signaling Technology). GST fusion {?!hUi+  
proteins were expressed in Escherichia coli BL21 (DE3) cells and were purified g$ 2M|Q  
according to the manufacturer's recommendations (GE Healthcare Life Science). Purified gZ+I( o{  
GST fusion protein lysates were incubated for 1 h at 4 °C with glutathione–Sepharose 4B 8m1zL[.8g  
beads. Bead-bound GST fusion proteins were separated by SDS-PAGE and were XS!ZTb>[  
quantified by Coomassie blue staining. f%|S>(   
GST precipitation assay. T^nX+;:|  
Jurkat cells were lysed in GST lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 ?s?uoZ /2  
mM MgCl2, 1% Nonidet-P40 and Complete Protease Inhibitors). Cell lysates were loaded N)!v-z,k  
onto columns of bead-bound GST fusion proteins. After columns were washed with GST 4z*_,@OA  
lysis buffer containing 150 mM and 200 mM NaCl, bound proteins were eluted with GST SRD&Uf0M  
lysis buffer containing 400 mM NaCl and SDS sample buffer, sequentially. Eluted OK)0no=OAK  
proteins were detected by SDS-PAGE and Coomassie blue staining. Protein bands were PaDT)RrEM  
identified with a Bruker Biflex III MALDI-TOF mass spectrometer (SpectroREADER; E{6}'FG+A  
Sequenom) and Protein Mass Fingerprinting Mascot search (Matrix Science). uLCU3nI  
Subcellular fractionation. |M?HdxPa  
Cells were lysed by brief sonication on ice in a buffer of 250 mM sucrose, 20 mM Tris, }O>Zu[8a  
pH 7.8, 10 mM MgCl2, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF and Complete 8;'n.SC{  
Protease Inhibitors. Lysates were centrifuged to remove nuclei and debris (900g for 5 min K$]QzPXS  
at 4 °C). The P100 and S100 fractions were separated by centrifugation for 30 min at "J.jmR;  
100,000g. Membrane fractions were made soluble with MLB (Upstate) plus protease and -J30g\  
phosphatase inhibitors. After centrifugation for additional 30 min at 100,000g, the :$tW9*\KY  
detergent-insoluble cytoskeleton-containing fraction was resolved by 0.5% SDS-PAGE. g.]'0)DMW  
Assessment of Intracellular Calcium Concentration .UYpPuAkn  
评价一下你浏览此帖子的感受

精彩

感动

搞笑

开心

愤怒

无聊

灌水

  
描述
快速回复

验证问题:
5+2=? 正确答案:7
按"Ctrl+Enter"直接提交