加入VIP 上传考博资料 您的流量 增加流量 考博报班 每日签到
   
主题 : 医学SCI 论文经典句子汇编
级别: 中级博友
显示用户信息 
楼主  发表于: 2009-10-18   

医学SCI 论文经典句子汇编

Title Jt0U`_  
要求简练,精确 ).AMfBQ=;  
Compassionate use of bevacizumab (Avastin) in children and young adults with 3gnO)"$  
refractory or recurrent solid tumors. 20}w . V  
Bevacizumab-induced transient remodeling of the vasculature in neuroblastoma *F!1xyg  
xenografts results in improved delivery and efficacy of systemically administered 4-I7"pW5  
chemotherapy. `?b'.Z_J  
Proteomics Approaches to the Systems Biology of Cardiovascular Diseases a&UzIFdB  
Pre- and post-natal treatment of hemophagocytic lymphohistiocytosis. g@T}h[  
Lack of early bevacizumab-related skeletal radiographic changes in children with \>G}DGz  
neuroblastoma. g> ~+M  
Interleukin-4 activates androgen receptor through CBP/p300 bwj{5-FU  
Trisomy 8 in an allogeneic stem cell transplant recipient representative of a 3 ^K#\*P  
donor-derived constitutional abnormality. O6vxp?:^  
Disruption of diacylglycerol metabolism impairs the induction of T cell anergy V)l:fUm2  
T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase- L AH">E  
High-dose conformal RT improves tumor control in patients with prostate cancer {dm>]@"S  
Vitamin D concentration does not affect the risk of prostate cancer wc. =`Me  
Liver resection with salvage transplantation for hepatocellular carcinoma O ;[Mi  
The impact of histopathologic diagnosis on the proper management of testis neoplasms nj1o !+9>$  
Prostate stem cell antigen is associated with diffuse-type gastric cancer jT}={[9b  
Multiple myeloma: high-risk immunophenotypes identified ^m&I^ \  
Increased c-kit expression predicts poor outcome in acute myeloid leukemia k54\H.  
Global Analysis of the Meiotic Crossover Landscape x^EW'-a  
Serum Response Factor Is Required for Sprouting Angiogenesis and Vascular Integrity Mgi~j.[  
Integrin Trafficking Regulated by Rab21 Is Necessary for Cytokinesis K3M.ZRh\;`  
Reduced Translocation of Nascent Prion Protein During ER Stress Contributes to 8Znr1=1   
Neurodegeneration 2[HPU M2>  
Effects of oral niacin on endothelial dysfunction in patients with coronary artery disease: `lWGwFgg(  
Results of the randomized, double-blind, placebo-controlled INEF study. ydo9 P5E  
Global experiences with vardenafil in men with erectile dysfunction and underlying _#NibW  
conditions. bxtH`^  
2 ybw\^t  
Noninvasive cardiac imaging: implications for risk assessment in adolescents and young  Pd\4hy  
adults. )Uy%iE*  
Transforming growth factor beta1 T29C gene polymorphism and hypertension: R54ae:8  
Relationship with cardiovascular and renal damage. Nr~!5XO  
A comparison of hormone therapies on the urinary excretion of prostacyclin and $!MP0f\q g  
thromboxane A2. 6?~9{0  
Repair of an infected aortic aneurysm using an aortic allograft and a venous autograft: E+qLj|IU  
Report of a case. W"\}##  
Circulating Leptin and Stress-induced Cardiovascular Activity in Humans. #~)A#~4O  
Effects of aspirin dose on ischaemic events and bleeding after percutaneous coronary c x$h"  
intervention: insights from the PCI-CURE study. C@eL9R;N1  
Long-term cardiovascular outcomes following ischemic heart disease in patients with and "Zh,;)hS  
without peripheral vascular disease. QK[^G6TI  
Reduced renal function and sleep-disordered breathing in community-dwelling elderly 19qH WU^0V  
men. m~AAO{\:b  
Intracoronary pharmacotherapy in the management of coronary microvascular -0kMh.JYR  
dysfunction. Ye&/O<G'V  
Inhibition of platelet aggregation by combined therapy with aspirin and cilostazol after e'A_4;~@s  
off-pump coronary artery bypass surgery. Lv['/!DJ|  
Inhibition of CCR2 Ameliorates Insulin Resistance and Hepatic Steatosis in db/db Mice x\8g ICf  
Abstract 要求简洁,连贯 (m:Q'4Ep  
The acquisition of metastatic ability by tumor cells is considered a late event in the T&dNjx  
evolution of malignant tumors. We report that untransformed mouse mammary cells that  Y4 z  
have been engineered to express the inducible oncogenic transgenes MYC and KrasD12, or kD)31P  
polyoma middle T, and introduced into the systemic circulation of a mouse can bypass 7>y]uT@ar  
transformation at the primary site and develop into metastatic pulmonary lesions upon #%k_V+o3  
immediate or delayed oncogene induction. Therefore, previously untransformed Q4-d|  
mammary cells may establish residence in the lung once they have entered the f tTD-d  
bloodstream and may assume malignant growth upon oncogene activation. Mammary nMzt_IlI  
cells lacking oncogenic transgenes displayed a similar capacity for long-term residence in \O"H#gt  
the lungs but did not form ectopic tumors. T$"~V u  
Almost two decades after CFTR was identified as the gene responsible for cystic fibrosis " $farDDoF  
(CF), we still lack answers to many questions about the pathogenesis of the disease, and it *sU,waX  
remains incurable. Mice with a disrupted CFTR gene have greatly facilitated CF studies, /B?wn=][  
but the mutant mice do not develop the characteristic manifestations of human CF, "zJxWXI  
including abnormalities of the pancreas, lung, intestine, liver, and other organs. Because 0SYJ*7lPX  
pigs share many anatomical and physiological features with humans, we generated pigs 7V::P_aUY  
with a targeted disruption of both CFTR alleles. Newborn pigs lacking CFTR exhibited #~-Xt! I  
defective chloride transport and developed meconium ileus, exocrine pancreatic [k\VUg:P  
destruction, and focal biliary cirrhosis, replicating abnormalities seen in newborn humans X5/j8=G H`  
3 !9 kNL  
with CF. The pig model may provide opportunities to address persistent questions about #oTVfY#  
CF pathogenesis and accelerate discovery of strategies for prevention and treatment. e8 ]C B  
Variable lymphocyte receptors (VLRs) rather than antibodies play the primary role in #M!$CGi (  
recognition of antigens in the adaptive immune system of jawless vertebrates. eR5q3E/;G  
Combinatorial assembly of leucine-rich repeat (LRR) gene segments achieves the U.SC,;N^  
required repertoire for antigen recognition. We have determined a crystal structure for a S y <E@1  
VLR-antigen complex, VLR RBC36 in complex with the H-antigen trisaccharide from ^2Cqy%x-  
human blood type O erythrocytes, at 1.67 angstrom resolution. RBC36 binds the 98R/ ^\  
H-trisaccharide on the concave surface of the LRR modules of the solenoid structure Tdh.U {Nz  
where three key hydrophilic residues, multiple van der Waals interactions, and the highly 33lh~+C  
variable insert of the carboxyl-terminal LRR module determine antigen recognition and vzI>:Bf  
specificity. The concave surface assembled from the most highly variable regions of the T DR|*Cs  
LRRs, along with diversity in the sequence and length of the highly variable insert, can H4 O"^#5  
account for the recognition of diverse antigens by VLRs. n]#YL4j  
A 51-year-old man with a diagnosis of myelodysplasia and non-Hodgkin's lymphoma Xk%eU>d  
underwent an unmatched allogenic bone marrow transplantation and was treated oe^JDb#  
posttransplant with chronic immunosuppressive medication. Eight months following 1VFCK&  
transplantation, he presented with progressive dysarthria, cognitive and visual decline. xM<aQf\j  
Evaluation included brain magnetic resonance (MR) imaging demonstrating multifocal ,x&WE@tD |  
areas of increased T2 and FLAIR (fluid attenuated inversion recovery) signals involving N~v<8vJq`  
the left frontal, parietal, and occipital lobes. The MR lesions demonstrated diffuse *y<eK0  
increased signal on DWI (diffusion-weighted images) and normal to low signal on ADC THOYx :Nr;  
(apparent diffusion coefficients). Contrast-enhanced T1 images were unremarkable. nt>3i! l  
Lumbar puncture revealed a mild elevation in cerebrospinal fluid (CSF) protein. CSF a U.3  
PCR assay for viral DNA fragments were negative on two occasions. Serum serology for <Ffru?o4j  
HIV was negative as well. A brain biopsy was subsequently performed. The clinical and [g"nu0sOK  
neuroimaging differential diagnoses as well as neuropathologic correlation are presented. U+B{\38  
In vitro-generated mesenchymal stem cells (MSCs) initially attracted interest for their qm_ r~j  
ability to undergo differentiation toward cells of different lineages.  rwSR  
These results suggested that 9wfE^E1  
However, there are still obstacles in ImB5F'HI$  
The major challenge for successful drug development is identifying delivery strategies H'$H@Kn]-  
that can be translated to the clinic. bydI+pVMo  
This review will discuss progress in developing and testing small RNAi-based drugs and Qo3Enwap=  
potential obstacles. -XnIDXM  
This review highlights what EY)?hJS,  
In addition, there are indications that J=kf KQV  
Proper consideration of all of these issues will be necessary in FU*q9s`  
These studies provide ?vWF[ DRd'  
This paper presents the potential applications and the hurdles facing anti-HCV siRNA "u sPzp5  
drugs. } @3q;u)  
The present review provides insight into the feasible therapeutic strategies of siRNA p {. 6  
technology, and its potential for silencing genes associated with HCV disease. 8]#J_|A6Z  
4 #$U/*~m $  
A basic problem in the design of xx is presented by the choice of a xx rate for the EUrIh2.Z  
measurement of experimental variables. }3WP:Et  
This paper examines a new measure of xx in xx based on fuzzy mathematics which %'. x vC  
overcomes the difficulties found in other xx measures. b O}&i3.L;  
This paper describes a system for the analysis of the xx. ;c|_z 9+  
The method involves the construction of xx from fuzzy relations. WCqa[=v)t  
The procedure is useful in analyzing how groups reach a decision. b$ 8R  
The technique used is to employ a newly developed and versatile xx algorithms. ?%ltoezf  
The usefulness of xx is also considered. b ~]v'|5[  
A brief methodology used in xx is discussed. x@)cj  
The analysis is useful in xx and xx problem. l*CCnqE  
A model is developed for a xx analysis using fuzzy matrices. hfc~HKLC  
Algorithms to combine these estimates and produce a xx are presented and justified. LtUw  
The use of the method is discussed and an example is given. D^s#pOZS  
Results of an experimental applications of this xx analysis procedure are given to e^;:iJ S  
illustrate the proposed technique. L|b[6[XTHL  
This paper analyses problems in LV$Ko_9eA  
This paper outlines the functions carried out by ... nu|,wE!i  
This paper includes an illustration of the ... h'vBWtMa  
This paper provides an overview and information useful for approaching &Wdi 5T8  
Emphasis is placed on the construction of a criterion function by which the xx in 77+3CME{'  
achieving a hierarchical system of objectives are evaluated. k %sxA  
The main emphasis is placed on the problem of xx f }.t  
Our proposed model is verified through experimental study. TB<$9FCHK  
The experimental results reveal interesting examples of fuzzy phases of : xx,xx K2v[_a~@  
The compatibility of a project in terms of cost, and xx are likewise represented by WD kE 5  
linguistic variables. r1=j$G  
A didactic example is included to illustrate the computational procedure ,@M<O!%Cs  
Introduction 引证核心文献,提出假设,指出文章的核心观点 :7Uv)@iUk  
Beginning 4}*.0'Hz  
Over the course of the past 30 years, .. has emerged form intuitive 23'<R i  
We evaluated 508 participants who {z;K0  
Acute kidney injury (AKI) is associated with an increased incidence of respiratory failure NP4u/C<  
requiring mechanical ventilation, which greatly increases mortality 7&]|c?([4  
The cause of respiratory failure in patients with AKI is incompletely understood 7G Erh,  
However, lung injury also occurs after ischemia–reperfusion injury of other organs such VH+3o?nrT  
as the liver, gut, and hind limb jlqSw4_  
We have demonstrated previously that _sL;E<)y(  
Given this background, we hypothesized that tef>Py  
we demonstrate that zITxJx  
Technological revolutions have recently hit the industrial world %z.d ;[Hs  
The advent of ... systems for has had a significant impact on the sint":1FC  
5 ^LXsU] R  
The development of ... is explored X Vo+ <&  
The concept of xx was investigated quite intensively in recent years }!|$;3t+c  
There has been a turning point in ... methodology in accordance with the advent of ... J!3;\  
A major concern in ... today is to continue to improve... ,":_CY4(  
It has become increasingly clear that tqpi{e  
In this paper, we focus on the need for 6g#E/ {kQw  
This paper proceeds as follow. -H|!KnR  
The structure of the paper is as follows. <F-IF7>a  
Our study %503 <j  
In this paper, we shall first briefly introduce… xbHI 4A" Z  
To begin with we will provide a brief background on the Imclz4'8  
This will be followed by a description of the xx of the problem and a detailed b+f '  
presentation of how the required membership functions are defined. i3$G)W  
Details on xx and xx are discussed in later sections. %@ q2  
Polyphenolic compounds are vasodilators and help to lower the risk of cardiovascular 9U )9u["DH  
diseases. )!G 10  
Taken together, our novel findings suggest that the EDR induced by the strawberry &arJe!K  
extract was mediated by activation of the PI3 kinase/Akt signaling pathway, resulting in v v5rA 6+  
phosphorylation of eNOS.  R; &k/v  
Objective / Goal / Purpose GyFA1%(o  
The purpose of the inference engine can be outlined as follows: j|p=JrCJ  
The ultimate goal of the xx system is to allow the non;experts to utilize the existing *7L1SjZw  
knowledge in the area of manual handling of loads, and to provide intelligent, x~D8XN{  
computer;aided instruction for xxx. :eevc7  
The paper concerns the development of a xx \SYeDy  
The scope of this research lies in 2Ib 1D  
The main theme of the paper is the application of rule;based decision making. l!\~T"-7;:  
These objectives are to be met with such thoroughness and confidence as to permit ... KO"+"1 .  
The objectives of the ... operations study are as follows: ?T|0"|\"'  
The primary purpose/consideration/objective of jj ' epbA  
The ultimate goal of this concept is to provide ']1a  
The main objective of such a ... system is to e9QjRx  
The aim of this paper is to provide methods to construct such probability distribution. #)S&Z><<  
In order to achieve these objectives, an xx must meet the following requirements: "%_T7 A ![  
In order to take advantage of their similarity ;W\?lGOs{  
more research is still required before final goal of ... can be completed Y\4B2:Qd9  
In this trial, the objective is to generate... 2)QZYgfh  
for the sake of concentrating on ... research issues ?@6Zv$vZ  
A major goal of this report is to extend the utilization of a recently developed procedure >S{8sN  
for the xx. 2 zX9c<S=5  
For an illustrative purpose, four well;known OR problems are studied in presence of hVd_1|/X  
fuzzy data: xx. Z:2%gU&W  
6 6 Pdao{P  
This illustration points out the need to specify rD !GEU  
Recent studies have further defined the role of SBP-2 in promoting UGA read-through, O+=}x]q*y  
This concept has been further validated with the discovery of patients with impaired B9c gVTLj  
deiodinase activity due to a mutation in SBP-2 E7/i_Xkk  
The ultimate goal is both descriptive and prescriptive. |U$ "GI  
A wealth of information is to be found in the statistics literature, for example, regarding Z=a~0&G  
xx WfTl\Dxw  
This review will focus on the most recent progress achieved in this field, particularly the ;Qc^xIPy  
cellular and molecular aspects of local control of thyroid hormone signaling provided by G%K&f1q%  
deiodinases. g\iSc~ %?  
A considerable amount of research has been done .. during the last decade WB `h)  
A great number of studies report on the treatment of uncertainties associated with xx. jTW8mWNk]  
There is considerable amount of literature on planning 6k {gI.SG  
However, these studies do not provide much attention to undertainty in xx. 7[0CVWs,  
Since then, the subject has been extensively explored and it is still under investigation as }I18|=TB  
well in methodological aspects as in concrete applications. sJ5#T iX  
Many research studies have been carried out on this topic. +NeoGnj  
Problem of xx draw recently more and more attention of system analysis. ni<\ AF] `  
Attempts to resolve this dilemma have resulted in the development of nAX/u[  
Many complex processes unfortunately, do not yield to this design procedure and have, &(|Ot`el]v  
therefore, not yet been automated. 2|NQ5OA0  
Most of the methods developed so far are deterministic and /or probabilistic in nature. O]61guxro  
The central issue in all these studies is to :0bjPQj  
The problem of xx has been studied by other investigators, however, these studies have JLg/fB3%  
been based upon classical statistical approaches. X `F>kp1  
Applied ... techniques to q &S@\b  
Characterized the ... system as kX)*:~*  
Developed an algorithm to Q~KzcB<  
Developed a system called ... which _c(h{dn  
Uses an iterative algorithm to deduce nE bZ8M  
Emphasized the need to b%0@nu4  
Identifies six key issues surrounding high technology Rv.IHSQUo  
A comprehensive study of the .. has been undertaken ZQ' |B  
Much work has been reported recently in these filed 0vMKyT3 c  
Proposed j'lC]}kH  
Presented b tbuE  
State that [lu+"V,<LJ  
Point out that the problem of 9 aKU}y  
Described t%@u)bp  
Illustrated H;ujB \+  
Indicated 0w vAtK|Q  
Has shown / showed cyh ;1Q  
Address 8>xd  
7 ?D(aky#cyc  
Highlights NSq29#  
A study on ...was done / developed by [] 43~v1pf{!  
Previous work, such as [] and [], deal only with i<q_d7-W'  
The approach taken by [] is ID<[=es6  
The system developed by [] consists ?JW/Stua  
A paper relevant to this research was published by [] $4^h>x  
[]'s model requires consideration of .. JbN,K  
[]' model draws attention to evolution in human development [@]i_L[  
[]'s model focuses on... qca=a }  
Little research has been conducted in applying ... to K@{R?j/+  
The published information that is relevant to this research... _B vGEM`o  
This study further shows that c4s,T"H  
Their work is based on the principle of \tP*Pz  
More history of ... can be found in xx et al. [1979]. 'aS: Azb  
Studies have been completed to established Zv9%}%7p  
The ...studies indicated that M<Y{Cs  
Though application of xx in the filed of xx has proliferated in recent years, effort in G+\&8fi0  
analyzing xx, especially xx, is lacking. `7.$ A U  
提出Problem / Issue / Question 或假设 Z2-"NB  
Unfortunately, real-world engineering problems such as manufacturing planning do not pr1kYMrqri  
fit well with this narrowly defined model. They tend to span broad activities and require oxJAI4{y 4  
consideration of multiple aspects. tJm1Q#||  
Remedy / solve / alleviate these problems jHV) TBr  
It has recently been reported that 8?w #=@s  
... is a difficult problem, yet to be adequately resolved 6LqF*$+$`  
Two major problems have yet to be addressed D4?cnwU  
An unanswered question V@\u<LO0G  
This problem in essence involves using x to obtain a solution. cs[nFfM  
An additional research issue to be tackled is .... jY ;Hdb''  
Some important issues in developing a ... system are discussed mILCC} K t  
The three prime issues can be summarized: is^5TL%@  
The situation leads to the problem of how to determine the ... Ci2*5n<  
There have been many attempts to s=Kz9WLy  
It is expected to be serious barrier to 5fLp?`T  
It offers a simple solution in a limited domain for a complex problem. c2]h.G83  
There are several ways to get around this problem. Fw^^sB  
As difficult as it seems to be, xx is by no means new. +;bZ(_ohG  
The problem is to recognize xx from a design representation. UgOhx- 8  
A xx problem can trace its roots to xx. ?ea5k*#a  
xx [1987] used a heuristic approach to simplify the complexity of the problem. : z\||f  
Several problems are associated with them. mt[ #=Yba  
Although some progress has been made in this area, at least two major obstacles must be V}JBv$+ko  
overcome before a fully automated system can be realized. Vw`%|x"Xz  
Most problems in practice are complicated XRP+0=0  
More problem surface here. ( v$ i  
Hamper effort toward a xx system xFA`sAucr  
In order to overcome the limitations due to incomplete and imprecise xx knowledge, a xx V=Z%y$1Bc  
program has been developed, which bases its knowledge upon the statistical analysis of a 7>EMr}f C  
sample population of xx %~0]o@LW7  
The above difficulties are real challenges faced by researchers attempting to develop >}d6)s|   
This type of mapping raises no controversy to the issue of membership function @[Wf!8_  
determination. ${97G#  
However, attempts to quantify the xx have met both theoretical and empirical problems. BLm}mb#/{  
It has become apparent that in order to apply this new methodological framework to AU;Iif6  
real;world problems and data, we have to pay attention to the problems of xx and xx. ler$HA%F]  
MATERIALS AND METHODS ]puDqu5!  
Materials r'@7aT&_  
Chemicals were purchased from Sigma (St Louis, MO), if not stated otherwise. y-Lm^ GW4  
Experiments were conducted in accordance with the NIH Guidelines for the Care and Use JZqJ&   
of Laboratory Animals. m`4N1egCt  
CsA, EGF, PD98059, U0126, AG1478, Wortmannin, and LY294002 were from o ,8;=f,7  
Calbiochem (San Diego, CA, USA). Anti-ERK1/2 and anti-Ras were from Transduction CU/Id`"tW  
Laboratories (Franklin Lakes, NJ, USA). Anti-phospho Raf-1 (Ser259), anti-phospho WJ\,Y} J  
Raf-1 (Ser338), anti-phospho PKB/Akt (Ser473), anti-PKB, anti-phospho EGFR (Tyr1068), Ctk1\quz  
anti-phospho ERK1/2 (Thr202/Tyr204), anti-PI3K 110 , anti-p53, and anti-phospho  p.,`3"C1  
MEK1/2 (Ser217/221) were from Cell Signalling (Danvers, MA, USA). Anti-MEK and )H&ZHaO,_  
anti-Raf-1 (C12) were from Santa Cruz (Santa cruz, CA, USA). Apigenin and all other Ze?H  
reagents were from Sigma (Saint Louis, MO, USA). yXf+dMv  
Animal tNAmA  
Eight- to ten-week-old male C57BL/6 mice (wild-type) and IL-6-deficient mice lEw!H^O4  
backcrossed over eight generations on a C57BL/6 background were used '1Ex{$Yk  
Mice were maintained on a standard diet and water was made freely available. 2=| Ks]<P  
All experiments were conducted with adherence to the NIH Guide for the Care and Use K )eyFc  
of Laboratory Animals. }#n d&ND  
The animal protocol was approved by the Animal Care and Use Committee of the LVy (O9g  
University of Colorado 8w~X4A,  
Three surgical procedures were performed as described previously:5 (1) sham operation, .la_u8 A]  
(2) ischemic AKI, and (3) bilateral nephrectomy. }RQHsS  
The abdomen was closed in one layer. ]zI*}(adu  
Sham surgery consisted of the same procedure except that clamps were not applied. u\f Qa QV  
9 6-\M }xq?  
For bilateral nephrectomy, renal pedicles were tied off with suture and then cut distally. XMLl>w2z  
The ureters were pinched off with forceps and the kidneys removed. ; Ji3|=4u  
Serum was collected as described previously.5 Blood urea nitrogen and creatinine were Uu|R]azbO  
measured using an autoanalyzer (Beckman Instruments, Fullerton, CA, USA). &B$%|~Y5  
Serum IL-6 was measured by ELISA according to assay instructions (R&D Systems, DyRU$U  
Minneapolis, MN, USA). U \F ?{/  
Five-micrometer sections of paraffin-embedded lung tissue were stained with }50s\H._C  
hematoxylin and eosin using standard protocols. Neutrophils were counted on the basis of cq$ _$jRx  
morphological criteria; at least 50 high-powered fields ( 40) were counted per slide. Xzqx8Kd  
Frozen lung was prepared for ELISA as described previously.5 Supernatants were &#'.I0n  
analyzed for protein content using a Bio-Rad DC protein assay kit (Hercules, CA, USA). n9k-OGJ  
KC and MIP-2 were determined by ELISA (R&D Systems, Minneapolis, MN, USA). \CYKj_c  
One-fourth lung was used to determine MPO activity as described previously. y!~ }7=  
Frozen lung was homogenized in radioimmunoprecipitation assay buffer with protease +y 48.5  
inhibitor; western blotting was performed as described previously.49 Goat anti-murine zSBR_N51  
ICAM-1 polyclonal antibody (R&D Systems, Minneapolis, MN, USA; 1:2000) or rat IG!(q%Gf  
anti-murine VCAM-1 monoclonal antibody (R&D Systems; 1:1000) were used. yY"n:&T(  
A total of 20 g anti-IL-6 antibody vs IgG control (eBioscience, San Diego, CA, USA) ?4_ME3$t  
was administered to wild-type mice by tail vein injection 1 h before surgery, 0fN; L;v  
intraperitoneally at the time of clamp removal (ischemic AKI) or nephrectomy (bilateral j!IkU}*c  
nephrectomy) and intraperitoneally 1 h following surgery (60 g total). R^yh,  
Experimental groups UDlM?r:f  
STZ-induced diabetic rats, a model of partial type I diabetes: SD rats received a single iz27yXHZ~  
intraperitoneal injection of freshly prepared STZ (65 mg kg-1 body weight, dissolved in e8k|%m<Sp  
100 mmol l-1 citric acid, pH 4.5), and confirmed 2 days later by PP blood glucose Lv>OBHD  
(>250 mg dl-1). t* =i8`8  
CTR rats: Vehicle-injected SD rats after 2 to 7 days, 14 to 30 days, and 90 days served as m=60a@o]  
CTR for the 2 and 7 days STZ, the 14 and 30 days STZ, and for the 90 days STZ, z#6(PZC}  
respectively. 9x#T j/5%  
Insulin treatment in STZ: Glc was normalized in seven animals during 12–14 days of *EFuK8 ;  
STZ by subcutaneous insulin implants (2U day-1; Lin Shin Canada, Ontario, Canada). :,.HJ[Vg&  
Cell Culture ##s :Ww  
Immortalized cells from the convoluted portion of mouse kidney proximal tubule 8>|<m'e^\r  
PKSV-PCT cells (PCT3 clone) were cultured in a medium A (DMEM/Ham's F12 (1:1, nHQWO   
v/v), 20 mM HEPES, 2 mM L-glutamine, 12.5 mM D-glucose, 60 nM sodium selenite, NZ% v{?  
5 g ml-1 transferrin, 50 nM dexamethasone, 100 U ml-1 penicillin, and 100 g ml-1 r<DPh5ReY  
streptomycin), supplemented with 2% fetal bovine serum, 5 g ml-1 insulin, 10 ng ml-1 -v9x tNg  
EGF, and 1 nM triiodothyronine at 37°C in a 95:5 air/CO2 water-saturated atmosphere. x.'Ys1M  
For all experiments, cells were seeded at 0.2 106 cells/ml and after 24 h with complete 5dL!e<<  
medium cells were starved for 16 h in medium A supplemented with 0.1% fetal bovine -=qHwcId  
10 -gv[u,R  
serum but not insulin, EGF, or triiodothyronine. CsA was dissolved in ethanol and all the PVrNS7 Rk/  
pharmacological inhibitors were in DMSO. In all cases, controls were carried out with /mK]O7O7  
cells treated with the corresponding vehicle alone. After treatments, cells were washed dA0 o{[o=  
twice with cold phosphate-buffered saline (PBS) and harvested with lysis buffer as in +a^0Q F-7  
Llorens et al [=>[2Ty  
Cell viability XLlJ|xhY-K  
After treatments, PCT3 cells were harvested and washed twice with cold PBS, and the J>fq5  
viable cells were counted with Trypan Blue Dye (Gibco-Life Technologies, Grand Island, Wli!s~c5Fo  
NY, USA) in a Neubauer chamber. Living cells exclude the dye, whereas dead cells will Ib"fHLWA^!  
take up the blue dye. For Hoechst staining, cells seeded in six-well dishes were washed y/"CWD/i  
twice with PBS and fixed for 15 min with 4% paraformaldehyde at room temperature. rfV{+^T;  
Then, cells were washed twice again with PBS and stained with Hoescht (5 g ml-1 in _Bhd@S!  
PBS) for 5 min. [>lQi X  
Western blots/ Immunoblot 8L*#zaSAf  
The protein content of cellular extracts was quantified by the Bradford assay.44 Gg%pU+'T  
Twenty-five microgram of total cell extract protein was run on SDS-polyacrylamide gel >P-'C^:V=  
electrophoresis gels, transferred onto polyvinylidene difluoride membranes, and tZ:fh  p  
incubated with the corresponding antibodies. The membranes were developed with the 6 df`]s c  
enhanced chemiluminescence method (Pierce, Rockford, IL, USA). |oR#j `  
Supernatants of growing or growth-arrested cells were centrifugated for 5 min at 10 000 g. Bd[H@oKru  
The cells were lysed as described. The proteins from supernatant and cell lysates were 1czU$!MV  
concentrated using heparin sepharose. The heparin sepharose was washed four times with W2A!BaH%  
phosphate-buffered saline containing protease inhibitors, dissolved in phosphate-buffered y 48zsm{  
saline/protease inhibitor and incubated with 500 g protein over night at 4°C. The Rj-4K@a8#N  
complexes were washed with phosphate-buffered saline/protease inhibitor and the rWJKK  
proteins were eluated with 100 l Laemmli buffer without bromophenol blue (10 min ULxgvq  
95°C). A 30 l probe was loaded in each lane and western blot analysis was performed as ngzQVaB9  
described, using a polyclonal antibody against CCN3 (K19M), which recognizes a MF +F8h>/  
C-terminal 19-aminoacid peptide of human CCN3. As a positive control, a supernatant _;:B@Z  
from adrenocortical cell cultures, which are known to secrete CCN3, was used. v5.KCc}"  
Cells were lysed in 0.5% (volume/volume) Triton X-100 lysis buffer and immunoblot 'N/u< `)  
analysis was done as described43. Immunoprecipitation with anti-CrkL or control rabbit h-\+# .YP  
antiserum was done as described44. Antibodies to the following were used: %%lJyLq'Vk  
phosphorylated Erk (910L; Cell Signaling); phosphorylated Jnk (V7932; Promega); Erk }jYVB|2  
(13-6200; Zymed); Jnk1 (sc-474), H-Ras (sc-35), C3G (sc-869), CrkL (sc-319), +aOX{1w  
RasGRP1 (sc-8430) and DGK- (sc-8722; all from Santa Cruz Biotechnologies); and 8[oZ>7LMzC  
DGK- (a gift from H. Kanoh, Sapporo Medical University, Sapporo, Japan). Images 2=X.$&a  
were scanned, followed by densitometry analysis with UN-SCAN-IT software (Silk [\=1|t5n~  
Scientific). au/5`  
11 {ApjOIxk  
Purified splenic T cells were stimulated for various times with 5 g/ml of anti-CD3 gVs@T'  
(500A2; BD Pharmingen) and were lysed in 1% Nonidet P-40 lysis buffer (1% 8 LsJ}c  
(volume/volume) Nonidet-40, 150 mM NaCl and 50 mM Tris, pH 7.4) with protease RF'&.RtVa  
inhibitors. Proteins were resolved by SDS-PAGE and were transferred to a Trans-Blot j_SUR)5  
Nitrocellulose membrane (Bio-Rad Laboratories); membranes were probed with aX.//T:':?  
antibodies specific to phosphorylated Erk (91015; Cell Signal Technology) and H1$n6J  
phospholipase C- 1 (05-163; Upstate Biotechnology). Membranes were stripped and iO}KERfU  
were reprobed for analysis of total Erk (SC-16982; Santa Cruz Biotechnology). Activated "FLiSz%ME  
Ras in cell lysates was determined by glutathione S-transferase–Raf—Ras-binding <6C:\{eo  
domain precipitation assay as described RT[ E$H  
Immunofluorescence microscopy. *Z3b6X'e  
Analysis of protein localization in 2C T cell–P815.B71 cell conjugates was done as o>HGfr,N  
described29. P815.B71 cells were labeled with CMAC (7-amino-4-chloromethylcoumarin) }`]Et99Q5  
Cell-Tracker Blue (Molecular Probes) and were mixed with equal numbers of anergic or Sp[]vm8N  
in vitro–primed 2C Rag2-/- T cells. After approximately 8 min, cells were fixed, were FPu$Nd&\  
made permeable and were stained with anti-GRP1 and anti-talin (Santa Cruz A&X XL~yH  
Biotechnologies) and with species-specific secondary antibodies conjugated to dAi.^! !  
fluorescein isothiocyanate or phycoerythrin, respectively. Samples were analyzed with a ?B<.d8i  
Zeiss Axiovert 100 microscope, and 15 conjugates were typically assigned scores. 5JS*6|IbD{  
Slidebook software (Intelligent Imaging Innovations) was used for image capture and  J {$c|  
deconvolution analysis. ImageJ 1.36b software (US National Institutes of Health) was c9+yU~(  
used for quantification of pixel intensity. br*PB]dU  
Measurement of ROS generation gq~"Z[T  
The assay is based on the incorporation of 2',7'-dichlorofluorescein diacetate into the cell. CaV)F3   
H2O2 and peroxidases are able to oxidize the cleaved DCFH to DCF, which is highly 8qoA5fW>  
fluorescent at 530 nm. To measure CsA-induced ROS generation, cells were washed Ei89Ngp\}  
twice with PBS, and fresh medium containing 20 M 2',7'-dichlorofluorescein diacetate x|g2H.n  
was added to previously treated cells. After 30 min cells were washed again, tripsinized, Nop 61zj  
and resuspended with cold PBS. Fluorescence was measure by flow cytometry on a ts r{-4V  
FACScan flow cytometer. Is9.A_0h  
Raf-1 activity (R(NEN  
Raf-1 immunoprecipitation and kinase assay were performed as described previously.45 gl!ht@;>ak  
Immunoprecipitated Raf was incubated for 30 min at 30°C with 0.8 mM ATP, 10 g ml-1 9 7pnq1b  
GST-MEK, and 100 g ml-1 GST-ERK2. An aliquot of the supernatant was used for +^*b]"[  
ERK2 activity assays using 0.5 mg ml-1 myelin basic protein and 0.1 mM [ -32P] ATP TV}=$\D  
(400 c.p.m. pmol-1). After 15 min incubation at 30°C, 12 l of 5 Laemmli loading o5G]|JM_  
buffer was added to the tubes and the mixture analyzed by SDS-polyacrylamide gel OXZx!h  
electrophoresis. Radiolabeled bands were quantified in a PhosphoImager. <"av /`;  
12 #;UoZJ B  
Semiquantitative RT-PCR. (@S 9>z4s  
Total RNA was isolated from freshly isolated thymocytes. Then, cDNA was prepared bnV)f<  
with the M-MuLV reverse transcriptase and random primers according to the /mwDVP<z /  
manufacturer's recommendations (New England Biolabs). Semiquantitative PCR analysis &?k`rF9  
of Tcrb VDJC (where 'C' is the constant region) and Cd3e cDNA was done as described51. "WH &BhQYD  
[32P]dCTP (GE Healthcare Life Science) was incorporated into PCR products for SRrp = >w?  
semiquantitative detection by autoradiography. 0UQ DB5u  
Real-time quantitative RT-PCR K] &GSro  
Total RNA was isolated from HMC or rat mesangial cells using the Invisorb Spin ozA%u,\7k  
Cell-RNA Mini Kit (Invitek, Berlin, Germany) or from isolated glomeruli using the biVsbxYurq  
RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA purity determination, cDNA (V"7H  
synthesis, and RT-PCR were performed as described.16 Primer sequences are listed in am/D$ (l1  
Table 2. Glyceraldehyde-3-phosphate dehydrogenase cDNA amplification was used as an ?S.LGc  
internal standard. Kc+9n%sp  
Total RNA was isolated from the frozen kidneys as described by Chomczynski and Ah zV?6e  
Sacchi47 and quantified by a photometer. One microgram of the resulting RNA was used H-8_&E?6m  
for reverse transcriptase (RT)-PCR. The cDNA was synthesized by MMLV reverse w7~&Xxa/  
transcriptase (Superscript-Invitrogen, Carlsbad, CA, USA). For quantification of renin P5'VLnE R{  
mRNA expression (sense: 5'-ATGAAGGGGGTGTCTGTGGGGTC-3', antisense: !0cb f&^:  
5'-ATGCGGGGAGGGTGGGCACCTG-3'), real-time RT-PCR was performed using a ")w~pZE&+  
Light Cycler Instrument (Roche Diagnostics Corp., Basel, Suisse) and the QuantiTect ,Uy~O(F t  
SYBR Green PCR kit (Qiagen, Hilden, Germany), with GAPDH (sense: \]Rmq_O  
5'-TTCATTGACCTCAACTACAT-3', antisense: 5'-GAGGGGCCATCCACAGTCTT-3') *k0;R[IAV  
as a control. PCR was run for 30 cycles with 15 s per 95°C denaturation, 20 s/58°C 4n%|h-!8  
annealing and 20 s/72°C elongation. To verify the accuracy of the amplicon, a melting ,_:6qn{  
curve analysis was done after amplification.Total renin mRNA content per kidney was l Ng)k1  
calculated from the yield of RNA extracted from the whole kidneys times the renin &cf_?4  
mRNA estimate obtained from the defined amount of RNA used for RT-PCR real time `U{#;  
measurement. For the RT-PCR real-time measurements, a pool of RNA from adult mouse yRz l}  
kidneys was generated, which served as standard for all RT-PCR runs. Thus, all renin 2-:`lrVd  
mRNA levels for the developing kidneys were estimated relative to the levels in adult bW zUWLa  
kidneys. Hlj3z3  
In vitro anergy assay.  FO qD  
Wild-type, Dgka-/- and Dgkz-/- splenocytes were stained with 5 M CFSE, were V}Pv}j:;  
stimulated for 72 h with anti-CD3 (1 g/ml; 2C11) along with CTLA-4–Fc (5 g/ml), ~bfjP2 g  
were stained with allophycocyanin-conjugated anti-CD4 and were analyzed by flow 5NMju!/  
cytometry. Cell division was assessed by CFSE dilution after gating on live CD4+ cells. &tw{d DD6  
Alternatively, cells were stimulated for 72 h and were pulsed with 1 Ci/well of 0|?DA12Z  
[3H]thymidine for the final 8 h of stimulation, and proliferation was assessed by tritium --TY[b  
incorporation with a scintillation counter. For restimulation analyses, cells were S?Uvt?  
13 #F+b^WTR  
prestimulated with anti-CD3 plus CTLA-4–Fc, then after 72 h, CD4+ cells were purified a<Ps6'  
by negative selection (with fluorescein isothiocyanate–conjugated anti-CD8, anti-B220 T2 V(P>E  
(RA3-6B2; BD Pharmingen), anti-DX5 and anti-CD11b (M1/70; BD Pharmingen), q)]S:$?BT  
followed by depletion with anti–fluorescein isothiocyanate magnetic beads) and were 8FBXdk?A  
allowed to 'rest' overnight at 37 °C. Live cells were then counted by Trypan blue =`wnng5m  
exclusion, and equivalent numbers of live cells were dropped onto monolayers of bone s?&UFyYb,  
marrow–derived macrophages coated with anti-CD3 (1 g/ml) and anti-CD28 (0.5 +4K'KpFzZ  
g/ml). After 24 h, supernatants were collected and IL-2 was quantified by ELISA =z2g}X  
according to the manufacturer's protocol (R&D Systems). o]0\Km  
Three-dimensional reconstruction /^Zgv-n  
Serial sections of kidney specimens were fixed and stained for renin and for SMA as *l'5z)]  
described above. Digitalization of the serial slices was performed using an AxioCam 1Gk'f?dw  
MRm camera (Zeiss, Jena, Germany) mounted on an Axiovert200M microscope (Zeiss) y!kM#DC^  
with fluorescence filters for renin and SMA (TRITC: filter set 43: Cy2: filter set 38 HE; T28Q(\C:}  
Zeiss). After acquisition, a stack of equal-sized images was built using the graphic tool -[>G@m:?e  
ImageJ (Wayne Rasband, NIH, Bethesda, MD, USA). The equalized data were then vv`,H~M6  
imported into the Amira 4.1 visualization software (Mercury Computer Systems Inc., N x/_+JWje  
Chelmsford, MA, USA) on a Dell Precision 690 computer system (Dell, Frankfurt, 9 X87"  
Germany), and subsequently split into the renin and SMA channels. After this step, the ~H`(zzk  
renin and SMA channels were aligned. In the segmentation step, the SMA and renin $lAhKpdlW  
data sets served as a scaffold and were spanned manually or automatically using (1;%V>,L  
grayscale values. Matrixes, volume surfaces, and statistics were generated from these `xu/|} )KI  
segments. 7f q\ H{  
Restimulation assay after in vivo immunization. #W=H)6  
For analysis of T cell priming in vivo, CD4+ T cells were collected from naive, primed or r!O4]j_3  
tolerized recipient mice on day 15 after immunization. Proliferative responses were yI}_ U  
measured by culture for 72 h of CD4+ T cells (3 106 cells/ml) with irradiated (3,000 rads) u[1'Ap  
APCs (10 106 cells/ml) and OVA(323–339). The number of KJ1-26+ cells for each -hpMd/F  
group of recipient mice was determined by flow cytometry and proliferation was |[ ,|S{  
normalized to the number of input KJ1-26+ cells. Supernatants were collected from plates o`ijdg!5qG  
and cytokine concentrations were measured by ELISA. #wZBWTj.  
Flow cytometry. p+|(lrYC  
For analysis of surface antigen expression, mAb to CD4 (JK1.5; eBioscience) and mAb ~0XV[$`L  
KJ1-26 (KJ-126; Caltag) were used. For intracellular IL-2 staining, T cells were bY7~b/  
restimulated for 24 h in vitro with OVA(323–339) in the presence of APCs as described X4:SH> U!  
above. Brefeldin A (eBioscience) was added for the last 6 h of the culture. Cells were rQD7ZN_ R  
collected and were stained with allophycocyanin-conjugated mAb to CD4 and fluorescein gjhWoZV  
isothiocyanate–conjugated mAb KJ1-26. Then, cells were fixed, were made permeable A+1>n^^_<  
and were stained with antibody to IL-2 (clone JES6-5H4; eBioscience) according to the ixIfJ  
manufacturer's instructions. L# NW<T  
14 !Typ_Cs  
TH1 cells transduced with adenovirus vector encoding GFP were analyzed with a t(?tPt4zp  
FACScan (BD Biosciences). A total of 1 104 events were acquired, and data were ,mW-O!$3W  
analyzed with CellQuest software (BD Biosciences). G/5]0]SO  
Splenic and lymph node samples depleted of thymocytes and red blood cells were stained c<j  +"  
with fluorescence-conjugated anti-CD3 (2C11), anti-CD4 (GK15), anti-CD8 (53-6.7), !aub@wH3  
anti-CD25 (7D4) and anti-CD44 (552407; all from BD Pharmingen). A three-color l:rT{l=8*  
FACScan (Becton Dickinson) was used for flow cytometry, and data were analyzed with - d(RK_  
FlowJo 4.6 (TreeStar). dJwE/s  
A FACSCalibur (Becton Dickinson) was used for flow cytometry. Human cells from pUXszPf  
transplanted NOD-SCID mice were assessed with phycoerythrin–cyanin 5–conjugated orzy &4  
anti–human CD45 and phycoerythrin-conjugated anti-CD19, anti-CD33, anti-CD36 and U:o(%dk  
anti–glycophorin A (Becton Dickinson). EGFP fluorescence was detected with channel `j yBF  
FL1 calibrated to the fluorescein isothiocyanate emission profile. During quadrant >rb8A6  
analysis, only fluorescence excluding more than 99% of isotypic control events was F lQ(iv)P  
considered specific. Cell Quest Pro software (Becton Dickinson) and FlowJo (Tree Star) z^r  
were used for data acquisition and analysis. q-)Ynp4'  
Mammalian expression plasmids and transfection. 51lN,VVD  
For generation of the plasmid expressing Smad3 shRNA, the following specific Ue22,Pp6  
oligonucleotides were used: upper, $"G=r(MW  
5'-GATCCACCTGAGTGAAGATGGAGATTCAAGAGATCTCCATCTTCACTCAGG ?y qTLj  
TTTTTTTACGCGTG-3'; lower, ]aF!0Fln~  
3'-AATTCACGCGTAAAAAAACCTGAGTGAAGATGGAGATCTCTTGAATCTCCA RY]Vo8  
TCTTCACTCAGGTG-5'. These were cloned under control of the U6 promoter into the R8<'m   
pSIREN-DNR-DsRed expression vector (Clontech, BD). Vector expressing shRNA (jY -MF3  
specific for luciferase served as a control. Smad3-Tm was subcloned into the E)=X8y  
pIRES2-EGFP vector (Clontech, BD); empty vector served as a control. Purified 1-M\K^F  
DO11.10 or DO11.10p27 T cells were transfected with plasmids by nucleofection with @ s2<y@  
the Amaxa nucleofection apparatus, according to the manufacturer's instructions (Mouse eQvdi|6  
T Cell Nucleofector Kit Amaxa Biosytems). Purified T cells were suspended in !?~>f>js_l  
nucleofector solution (3 106 cells/100 l) and were mixed with 3 g of plasmid. atA:v3"  
Samples were transferred into cuvettes, were transfected with nucleofector program X-01 <CnTiS#  
and were then immediately transferred into 12-well plates and were cultured in &:" [hU  
nucleofector medium for 3 h. Then, cells were collected and counted and were $ }D9)&f;  
immediately transferred into syngeneic recipient mice (3 106 cells per mouse). At 3 h qrtA'fU  
after adoptive transfer, mice were given priming or tolerizing treatment in vivo according ZdP2}w  
to the standard protocol described above. Lymphocytes were isolated from draining /Ky x Ob)  
lymph nodes at day 5 of the treatment, CD4+ T cells were purified and transfection &CEZ+\bA  
efficiency was assessed by flow cytometry. The range of transfection efficiency was g^dPA jPQ  
69–75% (Supplementary Fig. 4 online). Smad3-knockdown and control-knockdown CI };$4W~  
DO11.10 cells and DO11.10 cells transfected with Smad3-Tm and vector control were (\=iKE4#  
selected by cell sorting. The resulting CD4+ T cells (2 106 cells/ml) were restimulated J|z>5Z  
with OVA(323–339) (5 g/ml) in the presence of irradiated APCs in vitro. n 7Bua  
15 j\Z/R1RcW  
Luciferase assays. )j[rm   
CAR IL-2–Luc TH1 clones were transduced with vectors, were stimulated for 20 h and .jfkOt?2  
were resuspended in serum-free DMEM in luminometer cuvettes (BD Biosciences). An 8"\g?/  
equal volume of Bright-Glo luciferase assay reagent (Promega) was added to each sample, eaI!}#>R +  
followed by thorough mixing. After 2 min, samples were analyzed with a monolight 2010 FB-_a  
Luminometer (BD Biosciences). (KF=v31_m  
Analysis of cell divisions in vivo. '<35XjW  
Purified T cells from DO11.10 and DO11.10p27 mice (10 106 cells/ml) were labeled ) OAd[u<  
for 30 min at 37 °C with the intracellular fluorescent dye CFSE (5 M 5(and T!T6M6?  
6)-carboxyfluorescein succunimidyl ester; Molecular Probes). Then, cells were washed :$`"M#vMX  
twice with cold RPMI 1640 medium containing 10% FCS, were resuspended in PBS and wlM"Zt  
were transferred intravenously into BALB/c mice (5 106 cells per mouse). Syngeneic ]i3 1@O  
hosts were left untreated (naive) or were treated with PBS followed by immunization }BpCa6SAs  
with OVA(323–339) (primed) or with CTLA-4–Ig plus mAb to CD40L followed by PV*U4aP  
immunization with OVA(323–339) as described above (tolerized). Then, 3 d later, O<1qU M  
lymphocytes were isolated from the draining lymph nodes of the BALB/c hosts. The $ 'B0ZL  
number of cell divisions on CFSE-stained cells and the percentage of cells that had xt%-<%s%f  
undergone a specific number of divisions were determined as described43. Cells were also O+Zt*jN;  
stained with mAb KJ1-26 and CFSE analysis of KJ1-26+ T cells was done by flow )rTV}Hk  
cytometry. eN/o}<(e  
Adenovirus vectors. 3}@!TI  
The cDNA encoding Ras61L was provided by F. Fitch (University of Chicago, Chicago,  vj+x(  
Illinois). The dominant negative Cbl construct was generated by RT-PCR with cDNA `|1#Vuk  
from TH1 clones as a template and the following primers (upper case, restriction enzyme JY+ N+c\  
sequences; underlining, Myc tag sequence): q&h&GZ  
5'-GGGGTACCatggagcagaaactcatctctgaagaggatctggccggcaacgtgaagaaga-3' (forward) and 1Qi5t?{  
5'-ATAGTTTAGCGGCCGCtcaatcttgaggagttggtt cacataa-3' (reverse). The cDNA h|_E>6d)  
encoding DGK- was a gift from M. Topham (University of Utah, Salt Lake City, Utah) ^MyuD?va  
and was used as a template to introduce an N-terminal Myc epitope tag by PCR. The <_S>-;by  
sequences of all PCR products were confirmed before subcloning. Construction of /e^q>>z  
recombinant adenovirus vectors was done with a two-cosmid system that has been .kl _F7  
described42. *Txt`z[|  
Adenoviral transduction of CAR T cells. `wJR^O!e  
TH1 clones were purified from passage cultures by Ficoll-Hypaque centrifugation. HMQi:s7%  
Primary CAR 2C Rag2-/- CD8+ T cells were isolated from splenocytes by negative A8?uCkG  
selection with magnetic beads and antibody 'cocktails' (Stem Cell Technologies). CAR VpDNp (2  
TH1 cells were transduced with adenovirus vectors at high cell density (1 107 cells/ml) ,;aELhMZ  
in DMEM containing 2% (volume/volume) FCS and were incubated for 1 h at 37 °C, 'n7 )()"2  
16 hJavi>374  
followed by an overnight 'rest' at 37 °C in DMEM containing 5% (volume/volume) FCS u? a*bW  
at low cell density (4 105 cells/ml). y#'|=0vTvP  
Lentivirus production and infection protocols. LV4]YC  
A third-generation lentiviral vector encoding EGFP expressed from the human !2)$lM1@J  
phosphoglycerate kinase promoter was used as described29, 33. Cell populations were T+_pmDDN  
incubated overnight (about 16 h) in X-VIVO-10 medium (BioWhittaker) supplemented ""GeO%J8  
with 1% BSA (Stem Cell Technologies) and L-glutamine (Invitrogen) with viral S\"/=|\  
supernatant (multiplicity of infection of 130–180). Viral concentrations of 1.0 108 to 1.8 1 m)WM,L  
108 viral particles/ml, 2.0 107 to 4.4 107 viral particles/ml and 0.9 108 to 1.6 108 '%@fW:r~  
viral particles/ml and cell concentrations of 0.7 106 to 1.1 106 cells/ml, 1.0 105 to 2.5 1}A1P&2>  
105 cells/ml and 0.7 106 to 1.4 106 cells/ml for CD34+CD38lo, CD34+CD38- and Lin- sLGut7@Sg  
cord blood, respectively, were maintained. The efficiency of gene transfer was estimated 0XCtw6  
by progenitor cell assay as described33. Zrtyai{8l  
Apoptosis induction. uqaP\  
Spontaneous apoptosis of PMNs was detected after 22 h of incubation in culture media. g$c\(isY;  
In some experiments, zVAD-fmk (10-50 M), TNF (40 ng/ml), resolvin E1–methyl ester, t(-`==.R  
aspirin-triggered lipoxin A4 analog, PD1–methyl ester (10 nM) or TGF- (10 ng/ml) was 8+ P)V4}  
added. Vehicle treatment was 0.05% (volume/volume) ethanol. Peripheral blood T cells 5&WYL  
were activated by incubation for 3 d in 24-well plates coated with anti-CD3 (5 g/ml; ~J}{'l1{yf  
R&D Systems). Jurkat cells or activated peripheral blood T cells were incubated for 4–48 &,pL3Qos  
h with staurosporine (1–2 M) or Fas ligand (0.05–5 ng/ml), after which cells were mM| 313  
collected and used for flow cytometry or binding assays. In some experiments, %?gh;? GD  
zVAD-fmk (10–50 M; R&D Systems) was added to cells 20 min before the addition of 3jMHe~.E<  
apoptosis-indu YK[PC]w  
Mice strains and genotyping. T %   
The 129/Sv Rhoh-/- mice were generated by Targeting Laboratory. The entire coding &F4khga`^:  
region of mouse Rhoh is in its third exon; the targeting vector was designed to replace the _^+z2m+ ~N  
third exon of Rhoh with a neomycin-resistance cassette. The genotypes of Rhoh "pdq_35  
gene-targeted embryonic stem cells and transgenic mice were determined by Southern  M=Y}w?  
blot analysis of DNA digested with SpeI using a 5' Rhoh genomic DNA probe or by PCR )Mw<e  
analysis with primers. The 129/Sv Rhoh-/- mice were crossed with wild-type or p14 TCR Bvke@|]kW  
(V 2V 8) transgenic mice on a C57BL/6J background to generate Rhoh-/- or 's.%rre%  
p14tg/+Rhoh-/- compound mice. Mice used were littermates derived from backcross 8!a6)Zeux  
generations with an N of more than 2. The 129S6/SvEvTac-Rag2-/- mice were purchased u)]]9G _8  
from Taconic Animal Models. All animal experiments were approved by the Institutional RcQo1  
Animal Care and Use Committee of the Cincinnati Children's Hospital Research iGG;  
Foundation (Cincinnati, Ohio). RP}. Ei  
Antibodies and GST fusion proteins. A^/$ |@  
17 PP\nR @  
Fluorescence-conjugated monoclonal antibodies to the following mouse antigens were yH\z+A|  
used for flow cytometry: CD4 (RM4-5), CD8 (53-6.7), CD25 (7D4), CD44 (IM7), TCR n9.` 5BH7/  
-chain (H57-597), TCR (GL3), TCR V 8, TCR V 5 (MR9-4), CD69 (H1.2F3), CD5 9|Z25_sS  
(53-7.3), Gr-1 (RB6-8C5), Mac-1 (M1-70), NK1.1 (PK136), Thy1.2 (53-2.1), %kM|Hk3d  
CD45R–B220 (RA3-6B2), IgM (R6-60.2), BrdU (3D4) and Ter119 (Ly-76; all from m'|{AjH z6  
Pharmingen). For immunoblot analyses, antibodies to the following were used: RhoH9 u="VJ3  
(B4998), Zap70 phosphorylated at Y319 (17a), phosphorylated tyrosine (4G10) and Lat j7&57'  
(45; Pharmingen); hemagglutinin (3F10; Roche); -actin (AC-15; Sigma); CD3 5v51:g>c  
(6B10.2; Santa Cruz Biotechnology); and Lat phosphorylated at Y191 (3584), Zap70 {1H3VSY q  
(99F2), phosphorylated p42-p44 (Thr202-Tyr204; 197G2) and p42-p44 (9102; Cell |Qq_;x]  
Signaling Technology). Primary antibodies were detected with the secondary antibodies qla$}dnvc  
horseradish peroxidase–conjugated goat anti-mouse (7076) or goat anti-rabbit (7074; both Jh3(5d"MV  
Cell Signaling Technology), or donkey anti-rat (sc-2956; Santa Cruz Biotechnology) a78&<  
using enhanced chemiluminescence detection (Cell Signaling Technology). GST fusion .Rq|F  
proteins were expressed in Escherichia coli BL21 (DE3) cells and were purified yFp8 >  
according to the manufacturer's recommendations (GE Healthcare Life Science). Purified ?eUhHKS5  
GST fusion protein lysates were incubated for 1 h at 4 °C with glutathione–Sepharose 4B Iu`B7UOF  
beads. Bead-bound GST fusion proteins were separated by SDS-PAGE and were &5Ai&<q"p  
quantified by Coomassie blue staining. -5 -X[`cF  
GST precipitation assay. W~ 6ii\  
Jurkat cells were lysed in GST lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 lNtZd?=>  
mM MgCl2, 1% Nonidet-P40 and Complete Protease Inhibitors). Cell lysates were loaded }nrl2yp:%  
onto columns of bead-bound GST fusion proteins. After columns were washed with GST VH&6Tm1  
lysis buffer containing 150 mM and 200 mM NaCl, bound proteins were eluted with GST 6 /T_+K.k  
lysis buffer containing 400 mM NaCl and SDS sample buffer, sequentially. Eluted :G#>):  
proteins were detected by SDS-PAGE and Coomassie blue staining. Protein bands were _KSYt32N  
identified with a Bruker Biflex III MALDI-TOF mass spectrometer (SpectroREADER; ?zwPF;L*  
Sequenom) and Protein Mass Fingerprinting Mascot search (Matrix Science). :'-FaGy  
Subcellular fractionation. pVTx# rY  
Cells were lysed by brief sonication on ice in a buffer of 250 mM sucrose, 20 mM Tris, $i@~$m7d-  
pH 7.8, 10 mM MgCl2, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF and Complete &P Ru[!  
Protease Inhibitors. Lysates were centrifuged to remove nuclei and debris (900g for 5 min PqMU&H_  
at 4 °C). The P100 and S100 fractions were separated by centrifugation for 30 min at oi4tj.!J  
100,000g. Membrane fractions were made soluble with MLB (Upstate) plus protease and ~2Jvb[IM  
phosphatase inhibitors. After centrifugation for additional 30 min at 100,000g, the #S+GI!  
detergent-insoluble cytoskeleton-containing fraction was resolved by 0.5% SDS-PAGE. 3cK`RM `  
Assessment of Intracellular Calcium Concentration !QoOL<(){  
评价一下你浏览此帖子的感受

精彩

感动

搞笑

开心

愤怒

无聊

灌水

  
描述
快速回复

验证问题:
5+2=? 正确答案:7
按"Ctrl+Enter"直接提交