加入VIP 上传考博资料 您的流量 增加流量 考博报班 每日签到
   
主题 : 医学SCI 论文经典句子汇编
级别: 中级博友
显示用户信息 
楼主  发表于: 2009-10-18   

医学SCI 论文经典句子汇编

Title :aD_>,n  
要求简练,精确 ]@l;;Sp  
Compassionate use of bevacizumab (Avastin) in children and young adults with raM{!T :  
refractory or recurrent solid tumors. ~SwGZ  
Bevacizumab-induced transient remodeling of the vasculature in neuroblastoma =vL >&$  
xenografts results in improved delivery and efficacy of systemically administered %)e&" mq!|  
chemotherapy. Z[kVVE9b?  
Proteomics Approaches to the Systems Biology of Cardiovascular Diseases |}d+BD  
Pre- and post-natal treatment of hemophagocytic lymphohistiocytosis. 1WI^R lWd(  
Lack of early bevacizumab-related skeletal radiographic changes in children with /5?tXH "  
neuroblastoma. k?_uv  
Interleukin-4 activates androgen receptor through CBP/p300 ]'z 5%'  
Trisomy 8 in an allogeneic stem cell transplant recipient representative of a - P4X@s_;  
donor-derived constitutional abnormality. >ffQ264g=i  
Disruption of diacylglycerol metabolism impairs the induction of T cell anergy pO2XQYhrY  
T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase- d 0:;IUG  
High-dose conformal RT improves tumor control in patients with prostate cancer  e )]  
Vitamin D concentration does not affect the risk of prostate cancer - I~\  
Liver resection with salvage transplantation for hepatocellular carcinoma cY|@s?3NND  
The impact of histopathologic diagnosis on the proper management of testis neoplasms WT1d'@ LY  
Prostate stem cell antigen is associated with diffuse-type gastric cancer mC'<Ov<eJ  
Multiple myeloma: high-risk immunophenotypes identified g c W'  
Increased c-kit expression predicts poor outcome in acute myeloid leukemia \CYKj_c  
Global Analysis of the Meiotic Crossover Landscape 5zF$Q{3  
Serum Response Factor Is Required for Sprouting Angiogenesis and Vascular Integrity sTxbh2  
Integrin Trafficking Regulated by Rab21 Is Necessary for Cytokinesis k jx<;##R8  
Reduced Translocation of Nascent Prion Protein During ER Stress Contributes to 7<LCX{Uw  
Neurodegeneration c(s: f@ 1  
Effects of oral niacin on endothelial dysfunction in patients with coronary artery disease: t*Z4&Sy^  
Results of the randomized, double-blind, placebo-controlled INEF study. 26=G%F 6  
Global experiences with vardenafil in men with erectile dysfunction and underlying p }3$7CR/  
conditions. 43!E>mq  
2 4?c0rC<  
Noninvasive cardiac imaging: implications for risk assessment in adolescents and young $IJ"fs  
adults. xr31< 4B  
Transforming growth factor beta1 T29C gene polymorphism and hypertension: R'^J#"[  
Relationship with cardiovascular and renal damage. |Pv)&'B"  
A comparison of hormone therapies on the urinary excretion of prostacyclin and HHT8_c'CC#  
thromboxane A2. <_SdW 5BF<  
Repair of an infected aortic aneurysm using an aortic allograft and a venous autograft: yB4 eUa!1  
Report of a case. Y"TrF(C  
Circulating Leptin and Stress-induced Cardiovascular Activity in Humans. a._>?rVy  
Effects of aspirin dose on ischaemic events and bleeding after percutaneous coronary 3s#/d,+  
intervention: insights from the PCI-CURE study. m1RjD$fM  
Long-term cardiovascular outcomes following ischemic heart disease in patients with and (XV+aQ\A  
without peripheral vascular disease. (Y  
Reduced renal function and sleep-disordered breathing in community-dwelling elderly KB gFS%-W  
men. Tzfk_h3hE  
Intracoronary pharmacotherapy in the management of coronary microvascular u0%bv\$m  
dysfunction. "71Y{WQ   
Inhibition of platelet aggregation by combined therapy with aspirin and cilostazol after N,&bBp  
off-pump coronary artery bypass surgery. -gv[u,R  
Inhibition of CCR2 Ameliorates Insulin Resistance and Hepatic Steatosis in db/db Mice % "^CrG  
Abstract 要求简洁,连贯 /mK]O7O7  
The acquisition of metastatic ability by tumor cells is considered a late event in the dA0 o{[o=  
evolution of malignant tumors. We report that untransformed mouse mammary cells that +a^0Q F-7  
have been engineered to express the inducible oncogenic transgenes MYC and KrasD12, or ) IKqO:@  
polyoma middle T, and introduced into the systemic circulation of a mouse can bypass zG<>-?q~'  
transformation at the primary site and develop into metastatic pulmonary lesions upon  ozl>Au  
immediate or delayed oncogene induction. Therefore, previously untransformed |wyua@2  
mammary cells may establish residence in the lung once they have entered the pJ/{X=y  
bloodstream and may assume malignant growth upon oncogene activation. Mammary _!%@V=  
cells lacking oncogenic transgenes displayed a similar capacity for long-term residence in )00jRuF  
the lungs but did not form ectopic tumors. =P,pW  
Almost two decades after CFTR was identified as the gene responsible for cystic fibrosis yjM!M|  
(CF), we still lack answers to many questions about the pathogenesis of the disease, and it 3w+ +F@(  
remains incurable. Mice with a disrupted CFTR gene have greatly facilitated CF studies, 6 dYa07  
but the mutant mice do not develop the characteristic manifestations of human CF, 8]WcW/1r !  
including abnormalities of the pancreas, lung, intestine, liver, and other organs. Because Bf Q#5  
pigs share many anatomical and physiological features with humans, we generated pigs n%6=w9.%c  
with a targeted disruption of both CFTR alleles. Newborn pigs lacking CFTR exhibited G'Uq595'-  
defective chloride transport and developed meconium ileus, exocrine pancreatic ;.7]zn.X]2  
destruction, and focal biliary cirrhosis, replicating abnormalities seen in newborn humans Iz&<rL;s  
3 *]ME]2qP  
with CF. The pig model may provide opportunities to address persistent questions about G_xql_QR  
CF pathogenesis and accelerate discovery of strategies for prevention and treatment. #/)U0 IR)  
Variable lymphocyte receptors (VLRs) rather than antibodies play the primary role in %< Jj[F  
recognition of antigens in the adaptive immune system of jawless vertebrates. \mw5 ~Rf;  
Combinatorial assembly of leucine-rich repeat (LRR) gene segments achieves the Hh%|}*f_,  
required repertoire for antigen recognition. We have determined a crystal structure for a U \jFB*U  
VLR-antigen complex, VLR RBC36 in complex with the H-antigen trisaccharide from j{H IdP  
human blood type O erythrocytes, at 1.67 angstrom resolution. RBC36 binds the 5E2T*EXSh  
H-trisaccharide on the concave surface of the LRR modules of the solenoid structure ZsG J[  
where three key hydrophilic residues, multiple van der Waals interactions, and the highly *?o 'sTH  
variable insert of the carboxyl-terminal LRR module determine antigen recognition and EH]qYF.  
specificity. The concave surface assembled from the most highly variable regions of the vh^?M#\  
LRRs, along with diversity in the sequence and length of the highly variable insert, can MFqb_q+  
account for the recognition of diverse antigens by VLRs. $Eo-58<q  
A 51-year-old man with a diagnosis of myelodysplasia and non-Hodgkin's lymphoma cY.5z:7u~v  
underwent an unmatched allogenic bone marrow transplantation and was treated A9LVS&52  
posttransplant with chronic immunosuppressive medication. Eight months following "f-HOd\=  
transplantation, he presented with progressive dysarthria, cognitive and visual decline. qG#ZYcVec  
Evaluation included brain magnetic resonance (MR) imaging demonstrating multifocal (_fovV=  
areas of increased T2 and FLAIR (fluid attenuated inversion recovery) signals involving iL'j9_w,  
the left frontal, parietal, and occipital lobes. The MR lesions demonstrated diffuse ;;Jx1Q  
increased signal on DWI (diffusion-weighted images) and normal to low signal on ADC ;V84Dy#b  
(apparent diffusion coefficients). Contrast-enhanced T1 images were unremarkable. `|4k>5k  
Lumbar puncture revealed a mild elevation in cerebrospinal fluid (CSF) protein. CSF 2FEi-m}  
PCR assay for viral DNA fragments were negative on two occasions. Serum serology for M/YS%1  
HIV was negative as well. A brain biopsy was subsequently performed. The clinical and HaQox.v%  
neuroimaging differential diagnoses as well as neuropathologic correlation are presented. LmPpt3[  
In vitro-generated mesenchymal stem cells (MSCs) initially attracted interest for their M} Mgz  
ability to undergo differentiation toward cells of different lineages. , jCE hb  
These results suggested that ~g*5."-i  
However, there are still obstacles in W?du ]  
The major challenge for successful drug development is identifying delivery strategies rg I Z  
that can be translated to the clinic. ^O&&QRH~w  
This review will discuss progress in developing and testing small RNAi-based drugs and 8*&YQId~  
potential obstacles. (SByN7[g b  
This review highlights what STz@^A  
In addition, there are indications that 4j<[3~:0 o  
Proper consideration of all of these issues will be necessary in kT:?1w'  
These studies provide S]Aaf-X_  
This paper presents the potential applications and the hurdles facing anti-HCV siRNA bl#6B.*=  
drugs. #j"GS/y"  
The present review provides insight into the feasible therapeutic strategies of siRNA _Zxo <}w}y  
technology, and its potential for silencing genes associated with HCV disease. ]N:Wt2  
4 T/jxsIt3  
A basic problem in the design of xx is presented by the choice of a xx rate for the GF*uDJ Kp  
measurement of experimental variables. t"YN:y8-  
This paper examines a new measure of xx in xx based on fuzzy mathematics which M%7|7V<o)^  
overcomes the difficulties found in other xx measures. c!mMH~#  
This paper describes a system for the analysis of the xx. _AH_<Z(  
The method involves the construction of xx from fuzzy relations. <Ik5S1<h$H  
The procedure is useful in analyzing how groups reach a decision. #p-\Y7f  
The technique used is to employ a newly developed and versatile xx algorithms. N[N4!k )!$  
The usefulness of xx is also considered. l0tFj>q"  
A brief methodology used in xx is discussed. =FfR?6 ~  
The analysis is useful in xx and xx problem. e1hf{:&/G@  
A model is developed for a xx analysis using fuzzy matrices. gBZNO! a,d  
Algorithms to combine these estimates and produce a xx are presented and justified. Uh'W d_?  
The use of the method is discussed and an example is given. W!1 B~NH#  
Results of an experimental applications of this xx analysis procedure are given to S(0JBGC  
illustrate the proposed technique. #z}0]GJKj  
This paper analyses problems in EF;B)y=  
This paper outlines the functions carried out by ... bG+Gg*0p  
This paper includes an illustration of the ... P@Vs\wAT  
This paper provides an overview and information useful for approaching "@rHGxK  
Emphasis is placed on the construction of a criterion function by which the xx in n,{  
achieving a hierarchical system of objectives are evaluated. ACF_;4%&  
The main emphasis is placed on the problem of xx D2zqDo<+;  
Our proposed model is verified through experimental study.  1 K]  
The experimental results reveal interesting examples of fuzzy phases of : xx,xx u3sr"w&  
The compatibility of a project in terms of cost, and xx are likewise represented by 4thPR}DH}  
linguistic variables. 7r pTk&`  
A didactic example is included to illustrate the computational procedure 01IfvK  
Introduction 引证核心文献,提出假设,指出文章的核心观点 ;}k_  
Beginning N5b&tJb M0  
Over the course of the past 30 years, .. has emerged form intuitive TBgiA}|\D  
We evaluated 508 participants who N<QLvZh  
Acute kidney injury (AKI) is associated with an increased incidence of respiratory failure Gz7,g Y  
requiring mechanical ventilation, which greatly increases mortality 8qT^=K $  
The cause of respiratory failure in patients with AKI is incompletely understood u Npa2{S'  
However, lung injury also occurs after ischemia–reperfusion injury of other organs such mOb@w/f  
as the liver, gut, and hind limb qnO/4\qq  
We have demonstrated previously that OGW0lnQ/  
Given this background, we hypothesized that ~)5k%?.  
we demonstrate that z hU^~4F  
Technological revolutions have recently hit the industrial world >jc17BJq  
The advent of ... systems for has had a significant impact on the A \Z_br  
5 6lwWFR+k  
The development of ... is explored zZV9`cqZ{  
The concept of xx was investigated quite intensively in recent years RMAbu*D0  
There has been a turning point in ... methodology in accordance with the advent of ... h\8bo=  
A major concern in ... today is to continue to improve... :{?Pq8jP  
It has become increasingly clear that DhG{hQ[[  
In this paper, we focus on the need for Y7`Dx'x  
This paper proceeds as follow. Hlj3z3  
The structure of the paper is as follows.  FO qD  
Our study :kucDQE({?  
In this paper, we shall first briefly introduce… C 0L(ti;  
To begin with we will provide a brief background on the (- {.T  
This will be followed by a description of the xx of the problem and a detailed &y~GTEP  
presentation of how the required membership functions are defined. P2 +^7x?  
Details on xx and xx are discussed in later sections. dV"K x  
Polyphenolic compounds are vasodilators and help to lower the risk of cardiovascular Tg v]3 0F)  
diseases. wVUm!Y  
Taken together, our novel findings suggest that the EDR induced by the strawberry (@xr/9:i  
extract was mediated by activation of the PI3 kinase/Akt signaling pathway, resulting in KPa&P:R3  
phosphorylation of eNOS. 9>d~g!u=  
Objective / Goal / Purpose lI+KT_|L  
The purpose of the inference engine can be outlined as follows: ~<=wTns!  
The ultimate goal of the xx system is to allow the non;experts to utilize the existing *w1R>  
knowledge in the area of manual handling of loads, and to provide intelligent, n Ayyjd3!S  
computer;aided instruction for xxx. 9Oc(Gl5az  
The paper concerns the development of a xx {^Q1b.=  
The scope of this research lies in BEii:05  
The main theme of the paper is the application of rule;based decision making. Fh^Ax3P(  
These objectives are to be met with such thoroughness and confidence as to permit ... P L*kjrLu7  
The objectives of the ... operations study are as follows: .p\<niu7  
The primary purpose/consideration/objective of ~)!vhdBe  
The ultimate goal of this concept is to provide ](^BQc  
The main objective of such a ... system is to S d]`)  
The aim of this paper is to provide methods to construct such probability distribution. q6V\n:hKV  
In order to achieve these objectives, an xx must meet the following requirements: Su[f"2oR  
In order to take advantage of their similarity qF4pTQf  
more research is still required before final goal of ... can be completed I#](mRJ6  
In this trial, the objective is to generate... EP]OJ$6I  
for the sake of concentrating on ... research issues qISzn04  
A major goal of this report is to extend the utilization of a recently developed procedure wfBf&Z0{  
for the xx. Kv6#WN~  
For an illustrative purpose, four well;known OR problems are studied in presence of m-}6DN  
fuzzy data: xx. j*@EJ"Gm>  
6 m*H6\on:  
This illustration points out the need to specify FLOSdMYdw  
Recent studies have further defined the role of SBP-2 in promoting UGA read-through, Z/= HQ8  
This concept has been further validated with the discovery of patients with impaired oA $]%  
deiodinase activity due to a mutation in SBP-2 X5Ff2@."y|  
The ultimate goal is both descriptive and prescriptive. Z)H9D(Za  
A wealth of information is to be found in the statistics literature, for example, regarding ='GY:.N  
xx <LOas$  
This review will focus on the most recent progress achieved in this field, particularly the \J3n[6;  
cellular and molecular aspects of local control of thyroid hormone signaling provided by s4Y7x.-  
deiodinases. ttC+`0+H  
A considerable amount of research has been done .. during the last decade =[V  
A great number of studies report on the treatment of uncertainties associated with xx. 9x[|75}l  
There is considerable amount of literature on planning B3iU#   
However, these studies do not provide much attention to undertainty in xx. 9x9~u8j  
Since then, the subject has been extensively explored and it is still under investigation as $4*k=+wS  
well in methodological aspects as in concrete applications. E7UYJ)6]  
Many research studies have been carried out on this topic. %.;`0}b  
Problem of xx draw recently more and more attention of system analysis. 7Yd]#K{$  
Attempts to resolve this dilemma have resulted in the development of E0Jk=cq  
Many complex processes unfortunately, do not yield to this design procedure and have, yu] nK-Y7S  
therefore, not yet been automated. N8w@8|KM  
Most of the methods developed so far are deterministic and /or probabilistic in nature. ISl-W1u}  
The central issue in all these studies is to S`?cs^?  
The problem of xx has been studied by other investigators, however, these studies have 3"J85V%h]n  
been based upon classical statistical approaches. .ITR3]$  
Applied ... techniques to 6t(I.>-  
Characterized the ... system as bp?4)C*R  
Developed an algorithm to #GT4/Ej}W  
Developed a system called ... which +HOHu*D  
Uses an iterative algorithm to deduce m6=Jp<  
Emphasized the need to ^`XTs!.  
Identifies six key issues surrounding high technology >*aqYNft  
A comprehensive study of the .. has been undertaken A#P]|i  
Much work has been reported recently in these filed d;9F2,k$w  
Proposed T=n)ea A  
Presented #XJ`/\E]  
State that ^sA"&Vdr^  
Point out that the problem of l /\n7:  
Described ,:1_I`d>#X  
Illustrated ~9KxvQzt  
Indicated zU1[+JJY"{  
Has shown / showed >^fkHbgNQ  
Address P<<hg3@  
7 GE{u 2<%@  
Highlights ?QXc,*=N  
A study on ...was done / developed by [] t$W~X~//  
Previous work, such as [] and [], deal only with ;.<0lnV  
The approach taken by [] is _(Qec?[^Ps  
The system developed by [] consists RC| t-(Z  
A paper relevant to this research was published by [] ;^K4kK&f  
[]'s model requires consideration of .. MSw:Ay [9  
[]' model draws attention to evolution in human development LYv$U;*+  
[]'s model focuses on... mSu1/ ?PS  
Little research has been conducted in applying ... to \:/ : S"-  
The published information that is relevant to this research... CQ+WB TiC  
This study further shows that ~J Xqyw}  
Their work is based on the principle of s}pn5zMp:8  
More history of ... can be found in xx et al. [1979]. '&.QW$B\B_  
Studies have been completed to established V!Q1o!J  
The ...studies indicated that mz~aSbb|  
Though application of xx in the filed of xx has proliferated in recent years, effort in [e:mRMi  
analyzing xx, especially xx, is lacking. "$VqOSo  
提出Problem / Issue / Question 或假设 i"{ \ >  
Unfortunately, real-world engineering problems such as manufacturing planning do not oq<n5  
fit well with this narrowly defined model. They tend to span broad activities and require UaQR0,#0y  
consideration of multiple aspects. nz=X/J6  
Remedy / solve / alleviate these problems A\jX#gg  
It has recently been reported that \v'\ Ea~  
... is a difficult problem, yet to be adequately resolved zMUifMiAj  
Two major problems have yet to be addressed x[,HK{U|t  
An unanswered question JDyP..Dt  
This problem in essence involves using x to obtain a solution. u5, \Kz  
An additional research issue to be tackled is .... -}B&>w,5  
Some important issues in developing a ... system are discussed [a&|c%h  
The three prime issues can be summarized: 0t-!6  
The situation leads to the problem of how to determine the ... f ,?P1D\  
There have been many attempts to Ig hd,G-  
It is expected to be serious barrier to /GK1}h  
It offers a simple solution in a limited domain for a complex problem. SYPG.O? I  
There are several ways to get around this problem. n 6PXPc  
As difficult as it seems to be, xx is by no means new. F0O/SI(cA  
The problem is to recognize xx from a design representation. MVGznf?  
A xx problem can trace its roots to xx. /5ngPHy&  
xx [1987] used a heuristic approach to simplify the complexity of the problem. O43emL3  
Several problems are associated with them. vpoeK'bi,  
Although some progress has been made in this area, at least two major obstacles must be poqcoSL"}  
overcome before a fully automated system can be realized. 3aL8 gE  
Most problems in practice are complicated =kp-[7  
More problem surface here. iUv#oX H  
Hamper effort toward a xx system r>=)Y32Q  
In order to overcome the limitations due to incomplete and imprecise xx knowledge, a xx _]~gp.  
program has been developed, which bases its knowledge upon the statistical analysis of a ,DN>aEu1  
sample population of xx >Cb[  
The above difficulties are real challenges faced by researchers attempting to develop %<|w:z$vp  
This type of mapping raises no controversy to the issue of membership function GZ.F q  
determination. kxJ! #%w  
However, attempts to quantify the xx have met both theoretical and empirical problems. <+1d'VQ2  
It has become apparent that in order to apply this new methodological framework to s3+^q  
real;world problems and data, we have to pay attention to the problems of xx and xx. zj ;'0Zu  
MATERIALS AND METHODS W0]W[b,:u$  
Materials Le&SN7I  
Chemicals were purchased from Sigma (St Louis, MO), if not stated otherwise.  6j FD|  
Experiments were conducted in accordance with the NIH Guidelines for the Care and Use qSRE)C=)  
of Laboratory Animals. l-Hp^|3Wq  
CsA, EGF, PD98059, U0126, AG1478, Wortmannin, and LY294002 were from r Z0+mS'/G  
Calbiochem (San Diego, CA, USA). Anti-ERK1/2 and anti-Ras were from Transduction GA, 6G [E  
Laboratories (Franklin Lakes, NJ, USA). Anti-phospho Raf-1 (Ser259), anti-phospho "XWrd [Df  
Raf-1 (Ser338), anti-phospho PKB/Akt (Ser473), anti-PKB, anti-phospho EGFR (Tyr1068), :G/T{87H  
anti-phospho ERK1/2 (Thr202/Tyr204), anti-PI3K 110 , anti-p53, and anti-phospho k_p4 f%9  
MEK1/2 (Ser217/221) were from Cell Signalling (Danvers, MA, USA). Anti-MEK and 9?xMsu-H  
anti-Raf-1 (C12) were from Santa Cruz (Santa cruz, CA, USA). Apigenin and all other c#?JW:^|Df  
reagents were from Sigma (Saint Louis, MO, USA). l$ABOtM@  
Animal EgAM ,\  
Eight- to ten-week-old male C57BL/6 mice (wild-type) and IL-6-deficient mice o ]UG*2  
backcrossed over eight generations on a C57BL/6 background were used teO%w9ByY  
Mice were maintained on a standard diet and water was made freely available. Byx8`Cx1  
All experiments were conducted with adherence to the NIH Guide for the Care and Use n>d@}hyv  
of Laboratory Animals. FL}k0  
The animal protocol was approved by the Animal Care and Use Committee of the & 5!.!Z3  
University of Colorado Uq0GbLjv"  
Three surgical procedures were performed as described previously:5 (1) sham operation, r+T@WvS%W  
(2) ischemic AKI, and (3) bilateral nephrectomy. /%w9F  
The abdomen was closed in one layer. oxN~(H)/ #  
Sham surgery consisted of the same procedure except that clamps were not applied. F dR!jt  
9 %:bTOw[4r  
For bilateral nephrectomy, renal pedicles were tied off with suture and then cut distally. 86bl'FdKS  
The ureters were pinched off with forceps and the kidneys removed. =D<{uovQB  
Serum was collected as described previously.5 Blood urea nitrogen and creatinine were l+e L:C!  
measured using an autoanalyzer (Beckman Instruments, Fullerton, CA, USA). %E\&9,  
Serum IL-6 was measured by ELISA according to assay instructions (R&D Systems, 1&S34wJF  
Minneapolis, MN, USA).  >'>onAIL  
Five-micrometer sections of paraffin-embedded lung tissue were stained with S GAu.8Js  
hematoxylin and eosin using standard protocols. Neutrophils were counted on the basis of II !Nr{A  
morphological criteria; at least 50 high-powered fields ( 40) were counted per slide. X2avo|6e  
Frozen lung was prepared for ELISA as described previously.5 Supernatants were GtQ$`~r  
analyzed for protein content using a Bio-Rad DC protein assay kit (Hercules, CA, USA). JI{| 8)S  
KC and MIP-2 were determined by ELISA (R&D Systems, Minneapolis, MN, USA). [ugBVnma  
One-fourth lung was used to determine MPO activity as described previously. 9.F+)y@  
Frozen lung was homogenized in radioimmunoprecipitation assay buffer with protease 7_,)"J2^  
inhibitor; western blotting was performed as described previously.49 Goat anti-murine 9$-V/7@)  
ICAM-1 polyclonal antibody (R&D Systems, Minneapolis, MN, USA; 1:2000) or rat $O}:*.{(W  
anti-murine VCAM-1 monoclonal antibody (R&D Systems; 1:1000) were used. kHj|:,'sV  
A total of 20 g anti-IL-6 antibody vs IgG control (eBioscience, San Diego, CA, USA) W'f{u&<  
was administered to wild-type mice by tail vein injection 1 h before surgery, &&Sl0(6x[T  
intraperitoneally at the time of clamp removal (ischemic AKI) or nephrectomy (bilateral x1\ a_Kt  
nephrectomy) and intraperitoneally 1 h following surgery (60 g total). Q fI =  
Experimental groups 1BQB8i-,  
STZ-induced diabetic rats, a model of partial type I diabetes: SD rats received a single cTy;?(E  
intraperitoneal injection of freshly prepared STZ (65 mg kg-1 body weight, dissolved in zLQplw`#  
100 mmol l-1 citric acid, pH 4.5), and confirmed 2 days later by PP blood glucose sq6|J])GgU  
(>250 mg dl-1). nl9G1Sm(E  
CTR rats: Vehicle-injected SD rats after 2 to 7 days, 14 to 30 days, and 90 days served as tvH{[e$  
CTR for the 2 and 7 days STZ, the 14 and 30 days STZ, and for the 90 days STZ, /b*VFA/75  
respectively. >P7|-bV  
Insulin treatment in STZ: Glc was normalized in seven animals during 12–14 days of 'je=.{[lWt  
STZ by subcutaneous insulin implants (2U day-1; Lin Shin Canada, Ontario, Canada). E 9= a+l9  
Cell Culture #q`-"2"|  
Immortalized cells from the convoluted portion of mouse kidney proximal tubule Z-(Vfp4  
PKSV-PCT cells (PCT3 clone) were cultured in a medium A (DMEM/Ham's F12 (1:1, O=wA/T=w?  
v/v), 20 mM HEPES, 2 mM L-glutamine, 12.5 mM D-glucose, 60 nM sodium selenite, Vj^<V|=  
5 g ml-1 transferrin, 50 nM dexamethasone, 100 U ml-1 penicillin, and 100 g ml-1 -\mbrbG9H  
streptomycin), supplemented with 2% fetal bovine serum, 5 g ml-1 insulin, 10 ng ml-1 Fs rGI (x?  
EGF, and 1 nM triiodothyronine at 37°C in a 95:5 air/CO2 water-saturated atmosphere. L&td4`2y  
For all experiments, cells were seeded at 0.2 106 cells/ml and after 24 h with complete p#:.,;  
medium cells were starved for 16 h in medium A supplemented with 0.1% fetal bovine !^ko"^p   
10 !MNo 8dC;  
serum but not insulin, EGF, or triiodothyronine. CsA was dissolved in ethanol and all the `>^2MHF3LT  
pharmacological inhibitors were in DMSO. In all cases, controls were carried out with I4%&/~!  
cells treated with the corresponding vehicle alone. After treatments, cells were washed \wY? 6#;  
twice with cold phosphate-buffered saline (PBS) and harvested with lysis buffer as in HbWl:yU  
Llorens et al 9o7E/wP  
Cell viability o g.LD7&/  
After treatments, PCT3 cells were harvested and washed twice with cold PBS, and the 0m?v@K' l  
viable cells were counted with Trypan Blue Dye (Gibco-Life Technologies, Grand Island, 0( fN  
NY, USA) in a Neubauer chamber. Living cells exclude the dye, whereas dead cells will <5*cc8  
take up the blue dye. For Hoechst staining, cells seeded in six-well dishes were washed 9)={p9FZY  
twice with PBS and fixed for 15 min with 4% paraformaldehyde at room temperature. Z2d,J>-  
Then, cells were washed twice again with PBS and stained with Hoescht (5 g ml-1 in SdF*"]t  
PBS) for 5 min. ?A7&SdJaO  
Western blots/ Immunoblot Bor_Kib  
The protein content of cellular extracts was quantified by the Bradford assay.44 B6tp,Np5,  
Twenty-five microgram of total cell extract protein was run on SDS-polyacrylamide gel (Sc]dH  
electrophoresis gels, transferred onto polyvinylidene difluoride membranes, and U#v??Sl  
incubated with the corresponding antibodies. The membranes were developed with the !$ikH,Bh  
enhanced chemiluminescence method (Pierce, Rockford, IL, USA). 0tVZvXgTu  
Supernatants of growing or growth-arrested cells were centrifugated for 5 min at 10 000 g. OZdiM&Zss  
The cells were lysed as described. The proteins from supernatant and cell lysates were cPe0o'`[  
concentrated using heparin sepharose. The heparin sepharose was washed four times with M/ @1;a@\  
phosphate-buffered saline containing protease inhibitors, dissolved in phosphate-buffered &-#!]T-P:E  
saline/protease inhibitor and incubated with 500 g protein over night at 4°C. The 7VkT(xnm  
complexes were washed with phosphate-buffered saline/protease inhibitor and the mx  s=<  
proteins were eluated with 100 l Laemmli buffer without bromophenol blue (10 min )+2GF0%  
95°C). A 30 l probe was loaded in each lane and western blot analysis was performed as E.kGBA;a?  
described, using a polyclonal antibody against CCN3 (K19M), which recognizes a .L'>1H]B  
C-terminal 19-aminoacid peptide of human CCN3. As a positive control, a supernatant 6Zwrk-,A  
from adrenocortical cell cultures, which are known to secrete CCN3, was used. dwOB)B@{H  
Cells were lysed in 0.5% (volume/volume) Triton X-100 lysis buffer and immunoblot [@MV[$W5  
analysis was done as described43. Immunoprecipitation with anti-CrkL or control rabbit 9(k5Irv"'h  
antiserum was done as described44. Antibodies to the following were used: Gz;.?=&iF  
phosphorylated Erk (910L; Cell Signaling); phosphorylated Jnk (V7932; Promega); Erk U CzIOxp}  
(13-6200; Zymed); Jnk1 (sc-474), H-Ras (sc-35), C3G (sc-869), CrkL (sc-319), 7c|8>zES:E  
RasGRP1 (sc-8430) and DGK- (sc-8722; all from Santa Cruz Biotechnologies); and _SM5x,Zd  
DGK- (a gift from H. Kanoh, Sapporo Medical University, Sapporo, Japan). Images R%iyNK,  
were scanned, followed by densitometry analysis with UN-SCAN-IT software (Silk 1wpT"5B  
Scientific). e W&;r&26  
11 D4%5T>^LW[  
Purified splenic T cells were stimulated for various times with 5 g/ml of anti-CD3 ?2l#=t?PP  
(500A2; BD Pharmingen) and were lysed in 1% Nonidet P-40 lysis buffer (1% 0,*clvH\;  
(volume/volume) Nonidet-40, 150 mM NaCl and 50 mM Tris, pH 7.4) with protease %(h-cuhq  
inhibitors. Proteins were resolved by SDS-PAGE and were transferred to a Trans-Blot lNuZg9h  
Nitrocellulose membrane (Bio-Rad Laboratories); membranes were probed with K:&FW l.  
antibodies specific to phosphorylated Erk (91015; Cell Signal Technology) and ](yw2c;m e  
phospholipase C- 1 (05-163; Upstate Biotechnology). Membranes were stripped and iLf:an*vH  
were reprobed for analysis of total Erk (SC-16982; Santa Cruz Biotechnology). Activated 42mi 7%f  
Ras in cell lysates was determined by glutathione S-transferase–Raf—Ras-binding )3g7dtq}  
domain precipitation assay as described %O-RhB4q  
Immunofluorescence microscopy. p#HbN#^Hy  
Analysis of protein localization in 2C T cell–P815.B71 cell conjugates was done as dj,7lJy  
described29. P815.B71 cells were labeled with CMAC (7-amino-4-chloromethylcoumarin) |r*btyOJk  
Cell-Tracker Blue (Molecular Probes) and were mixed with equal numbers of anergic or <I .p{Z  
in vitro–primed 2C Rag2-/- T cells. After approximately 8 min, cells were fixed, were Oo{+W 5[  
made permeable and were stained with anti-GRP1 and anti-talin (Santa Cruz ro{ q':Z3  
Biotechnologies) and with species-specific secondary antibodies conjugated to VP^Yph 8R  
fluorescein isothiocyanate or phycoerythrin, respectively. Samples were analyzed with a gIv :<EJ9  
Zeiss Axiovert 100 microscope, and 15 conjugates were typically assigned scores. j.O7-t%C  
Slidebook software (Intelligent Imaging Innovations) was used for image capture and $P#Cf&R  
deconvolution analysis. ImageJ 1.36b software (US National Institutes of Health) was oK1"8k|Z  
used for quantification of pixel intensity. /5M@>A^?'  
Measurement of ROS generation H'68K8i0  
The assay is based on the incorporation of 2',7'-dichlorofluorescein diacetate into the cell. K$_Rno"  
H2O2 and peroxidases are able to oxidize the cleaved DCFH to DCF, which is highly g`~c|bx  
fluorescent at 530 nm. To measure CsA-induced ROS generation, cells were washed n]I_ LlbY  
twice with PBS, and fresh medium containing 20 M 2',7'-dichlorofluorescein diacetate @a,X{ 0  
was added to previously treated cells. After 30 min cells were washed again, tripsinized, ])paU8u  
and resuspended with cold PBS. Fluorescence was measure by flow cytometry on a OoOKr  
FACScan flow cytometer. IE*GF27n  
Raf-1 activity W tF  
Raf-1 immunoprecipitation and kinase assay were performed as described previously.45 |@pJ]  
Immunoprecipitated Raf was incubated for 30 min at 30°C with 0.8 mM ATP, 10 g ml-1 pni n;;D*  
GST-MEK, and 100 g ml-1 GST-ERK2. An aliquot of the supernatant was used for "(j.:jayd  
ERK2 activity assays using 0.5 mg ml-1 myelin basic protein and 0.1 mM [ -32P] ATP b%>vhj&F  
(400 c.p.m. pmol-1). After 15 min incubation at 30°C, 12 l of 5 Laemmli loading Ijq',@jE  
buffer was added to the tubes and the mixture analyzed by SDS-polyacrylamide gel q)R&npP7  
electrophoresis. Radiolabeled bands were quantified in a PhosphoImager. %0 (,f  
12 9Mo(3M  
Semiquantitative RT-PCR. {`fhcEC  
Total RNA was isolated from freshly isolated thymocytes. Then, cDNA was prepared 8XtZF,Du  
with the M-MuLV reverse transcriptase and random primers according to the e|Iylv[3  
manufacturer's recommendations (New England Biolabs). Semiquantitative PCR analysis hKv3;jcd  
of Tcrb VDJC (where 'C' is the constant region) and Cd3e cDNA was done as described51. ^G'8!!ys  
[32P]dCTP (GE Healthcare Life Science) was incorporated into PCR products for ~6!{\un   
semiquantitative detection by autoradiography. P6w!r>?6N  
Real-time quantitative RT-PCR ]0P-?O:  
Total RNA was isolated from HMC or rat mesangial cells using the Invisorb Spin tU7,nE>p  
Cell-RNA Mini Kit (Invitek, Berlin, Germany) or from isolated glomeruli using the 9?B}CCE<LR  
RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA purity determination, cDNA FEgM4m.(G<  
synthesis, and RT-PCR were performed as described.16 Primer sequences are listed in C;2!c  
Table 2. Glyceraldehyde-3-phosphate dehydrogenase cDNA amplification was used as an aW hhq@  
internal standard. l1}=>V1  
Total RNA was isolated from the frozen kidneys as described by Chomczynski and @dE|UZ=(  
Sacchi47 and quantified by a photometer. One microgram of the resulting RNA was used vgRjd1k.\y  
for reverse transcriptase (RT)-PCR. The cDNA was synthesized by MMLV reverse f?: o  
transcriptase (Superscript-Invitrogen, Carlsbad, CA, USA). For quantification of renin xZAc~~9tD  
mRNA expression (sense: 5'-ATGAAGGGGGTGTCTGTGGGGTC-3', antisense: 1<a+91*=e  
5'-ATGCGGGGAGGGTGGGCACCTG-3'), real-time RT-PCR was performed using a 0/?V _  
Light Cycler Instrument (Roche Diagnostics Corp., Basel, Suisse) and the QuantiTect <+D(GH};  
SYBR Green PCR kit (Qiagen, Hilden, Germany), with GAPDH (sense: hMz= \)Pl  
5'-TTCATTGACCTCAACTACAT-3', antisense: 5'-GAGGGGCCATCCACAGTCTT-3') |@KW~YlE  
as a control. PCR was run for 30 cycles with 15 s per 95°C denaturation, 20 s/58°C 0g% `L_e_  
annealing and 20 s/72°C elongation. To verify the accuracy of the amplicon, a melting i-Ck:-J  
curve analysis was done after amplification.Total renin mRNA content per kidney was PR?Ls{}p\  
calculated from the yield of RNA extracted from the whole kidneys times the renin 5]yQMY\2)  
mRNA estimate obtained from the defined amount of RNA used for RT-PCR real time ` MIZqHM @  
measurement. For the RT-PCR real-time measurements, a pool of RNA from adult mouse \{  
kidneys was generated, which served as standard for all RT-PCR runs. Thus, all renin 'Ba Ba =  
mRNA levels for the developing kidneys were estimated relative to the levels in adult dc UaZfON  
kidneys. LwIl2u*  
In vitro anergy assay. /bm$G"%d  
Wild-type, Dgka-/- and Dgkz-/- splenocytes were stained with 5 M CFSE, were MHo(j%I1E  
stimulated for 72 h with anti-CD3 (1 g/ml; 2C11) along with CTLA-4–Fc (5 g/ml), MKIX(r( |  
were stained with allophycocyanin-conjugated anti-CD4 and were analyzed by flow t-_~jZ<  
cytometry. Cell division was assessed by CFSE dilution after gating on live CD4+ cells. P)x&9OHV  
Alternatively, cells were stimulated for 72 h and were pulsed with 1 Ci/well of 0NlC|5ma)  
[3H]thymidine for the final 8 h of stimulation, and proliferation was assessed by tritium =Tv;?U C  
incorporation with a scintillation counter. For restimulation analyses, cells were :tclYX  
13 guJS;VC6U  
prestimulated with anti-CD3 plus CTLA-4–Fc, then after 72 h, CD4+ cells were purified h^ wu8E   
by negative selection (with fluorescein isothiocyanate–conjugated anti-CD8, anti-B220 5e tbJk  
(RA3-6B2; BD Pharmingen), anti-DX5 and anti-CD11b (M1/70; BD Pharmingen), 2 LS03 27  
followed by depletion with anti–fluorescein isothiocyanate magnetic beads) and were 9m^"ca  
allowed to 'rest' overnight at 37 °C. Live cells were then counted by Trypan blue I6?n>  
exclusion, and equivalent numbers of live cells were dropped onto monolayers of bone Wj0=cIb  
marrow–derived macrophages coated with anti-CD3 (1 g/ml) and anti-CD28 (0.5 x { Z_rD  
g/ml). After 24 h, supernatants were collected and IL-2 was quantified by ELISA HD^Ou5YB  
according to the manufacturer's protocol (R&D Systems).  Er( I6  
Three-dimensional reconstruction 7,0^|P  
Serial sections of kidney specimens were fixed and stained for renin and for SMA as aH7i$U&  
described above. Digitalization of the serial slices was performed using an AxioCam !,8jB(  
MRm camera (Zeiss, Jena, Germany) mounted on an Axiovert200M microscope (Zeiss) m$b5Vqq  
with fluorescence filters for renin and SMA (TRITC: filter set 43: Cy2: filter set 38 HE; v%gkQa  
Zeiss). After acquisition, a stack of equal-sized images was built using the graphic tool I =G3  
ImageJ (Wayne Rasband, NIH, Bethesda, MD, USA). The equalized data were then G Y??q8  
imported into the Amira 4.1 visualization software (Mercury Computer Systems Inc., "9 W] TG  
Chelmsford, MA, USA) on a Dell Precision 690 computer system (Dell, Frankfurt, f.Wip)g  
Germany), and subsequently split into the renin and SMA channels. After this step, the CG@3z@*?.  
renin and SMA channels were aligned. In the segmentation step, the SMA and renin i=Nq`BoQf  
data sets served as a scaffold and were spanned manually or automatically using kw,eTB<;R  
grayscale values. Matrixes, volume surfaces, and statistics were generated from these %eK=5Er jx  
segments. x"/DCcZ  
Restimulation assay after in vivo immunization. ybsQ[9_36  
For analysis of T cell priming in vivo, CD4+ T cells were collected from naive, primed or 04;E^,V  
tolerized recipient mice on day 15 after immunization. Proliferative responses were -G\svwv@)  
measured by culture for 72 h of CD4+ T cells (3 106 cells/ml) with irradiated (3,000 rads) T!-*;yu  
APCs (10 106 cells/ml) and OVA(323–339). The number of KJ1-26+ cells for each S5o\joc  
group of recipient mice was determined by flow cytometry and proliferation was 7 'T3W c  
normalized to the number of input KJ1-26+ cells. Supernatants were collected from plates ;U+4!N  
and cytokine concentrations were measured by ELISA. Ag[Zs%X  
Flow cytometry. is?#wrV=K  
For analysis of surface antigen expression, mAb to CD4 (JK1.5; eBioscience) and mAb 2bu,_<K.  
KJ1-26 (KJ-126; Caltag) were used. For intracellular IL-2 staining, T cells were B{}<DP.  
restimulated for 24 h in vitro with OVA(323–339) in the presence of APCs as described Ax"]+pb  
above. Brefeldin A (eBioscience) was added for the last 6 h of the culture. Cells were Ez()W,6]g  
collected and were stained with allophycocyanin-conjugated mAb to CD4 and fluorescein ~PaEhj&8  
isothiocyanate–conjugated mAb KJ1-26. Then, cells were fixed, were made permeable YK xkO  
and were stained with antibody to IL-2 (clone JES6-5H4; eBioscience) according to the ,\fp .K<  
manufacturer's instructions. \zCw&#D0Z  
14 D*T*of G  
TH1 cells transduced with adenovirus vector encoding GFP were analyzed with a _?VMSu   
FACScan (BD Biosciences). A total of 1 104 events were acquired, and data were 9w)W|9  
analyzed with CellQuest software (BD Biosciences). #uRj 9|E7  
Splenic and lymph node samples depleted of thymocytes and red blood cells were stained e\8|6< o[  
with fluorescence-conjugated anti-CD3 (2C11), anti-CD4 (GK15), anti-CD8 (53-6.7), -uk}Fou  
anti-CD25 (7D4) and anti-CD44 (552407; all from BD Pharmingen). A three-color gWK[%.Jnw  
FACScan (Becton Dickinson) was used for flow cytometry, and data were analyzed with 19h@fA[:  
FlowJo 4.6 (TreeStar). ?hC,49  
A FACSCalibur (Becton Dickinson) was used for flow cytometry. Human cells from u~pBMg ,  
transplanted NOD-SCID mice were assessed with phycoerythrin–cyanin 5–conjugated |Eyn0\OA  
anti–human CD45 and phycoerythrin-conjugated anti-CD19, anti-CD33, anti-CD36 and o=zr]vv  
anti–glycophorin A (Becton Dickinson). EGFP fluorescence was detected with channel +nAbcBJAl  
FL1 calibrated to the fluorescein isothiocyanate emission profile. During quadrant EvP\;7B  
analysis, only fluorescence excluding more than 99% of isotypic control events was s~p(59  
considered specific. Cell Quest Pro software (Becton Dickinson) and FlowJo (Tree Star) >0X_UDAWz  
were used for data acquisition and analysis. W9D~:>^YP  
Mammalian expression plasmids and transfection. M*gbA5  
For generation of the plasmid expressing Smad3 shRNA, the following specific 1IPRI<1U  
oligonucleotides were used: upper, XN&cM,   
5'-GATCCACCTGAGTGAAGATGGAGATTCAAGAGATCTCCATCTTCACTCAGG `B$rr4_  
TTTTTTTACGCGTG-3'; lower, y*#YIS56I  
3'-AATTCACGCGTAAAAAAACCTGAGTGAAGATGGAGATCTCTTGAATCTCCA 11iV{ h  
TCTTCACTCAGGTG-5'. These were cloned under control of the U6 promoter into the d-cW47  
pSIREN-DNR-DsRed expression vector (Clontech, BD). Vector expressing shRNA kBeYl+*pk  
specific for luciferase served as a control. Smad3-Tm was subcloned into the l`<1Y|  
pIRES2-EGFP vector (Clontech, BD); empty vector served as a control. Purified yZV Y3<]  
DO11.10 or DO11.10p27 T cells were transfected with plasmids by nucleofection with =E w<s5C@  
the Amaxa nucleofection apparatus, according to the manufacturer's instructions (Mouse >ZwDcuJ~Lz  
T Cell Nucleofector Kit Amaxa Biosytems). Purified T cells were suspended in 3y%,f|ju  
nucleofector solution (3 106 cells/100 l) and were mixed with 3 g of plasmid. 5X73@Aj  
Samples were transferred into cuvettes, were transfected with nucleofector program X-01 6_L<&RmL g  
and were then immediately transferred into 12-well plates and were cultured in Sq SiuO.D  
nucleofector medium for 3 h. Then, cells were collected and counted and were LzQOzl@z  
immediately transferred into syngeneic recipient mice (3 106 cells per mouse). At 3 h Itz[%Dbiq9  
after adoptive transfer, mice were given priming or tolerizing treatment in vivo according r"9hpZH  
to the standard protocol described above. Lymphocytes were isolated from draining wq7h8Z}l  
lymph nodes at day 5 of the treatment, CD4+ T cells were purified and transfection `t"7[Zk  
efficiency was assessed by flow cytometry. The range of transfection efficiency was D (WdI  
69–75% (Supplementary Fig. 4 online). Smad3-knockdown and control-knockdown M`&78j  
DO11.10 cells and DO11.10 cells transfected with Smad3-Tm and vector control were t3b M4+n  
selected by cell sorting. The resulting CD4+ T cells (2 106 cells/ml) were restimulated " ?Ux\)*  
with OVA(323–339) (5 g/ml) in the presence of irradiated APCs in vitro. skYHPwJdW  
15 VXnWY8\  
Luciferase assays. 7_R[ =t  
CAR IL-2–Luc TH1 clones were transduced with vectors, were stimulated for 20 h and :*ZijN*{)$  
were resuspended in serum-free DMEM in luminometer cuvettes (BD Biosciences). An & }7+.^  
equal volume of Bright-Glo luciferase assay reagent (Promega) was added to each sample, p}Um+I=1  
followed by thorough mixing. After 2 min, samples were analyzed with a monolight 2010 V aoqI  
Luminometer (BD Biosciences). Kk,u{EA  
Analysis of cell divisions in vivo. u+O"c  
Purified T cells from DO11.10 and DO11.10p27 mice (10 106 cells/ml) were labeled vq+4so )/S  
for 30 min at 37 °C with the intracellular fluorescent dye CFSE (5 M 5(and z(u,$vZ _  
6)-carboxyfluorescein succunimidyl ester; Molecular Probes). Then, cells were washed v|KGzQx$.*  
twice with cold RPMI 1640 medium containing 10% FCS, were resuspended in PBS and }5;/!P_A  
were transferred intravenously into BALB/c mice (5 106 cells per mouse). Syngeneic <iBn-EG l>  
hosts were left untreated (naive) or were treated with PBS followed by immunization / */"gz%  
with OVA(323–339) (primed) or with CTLA-4–Ig plus mAb to CD40L followed by vJ{F)0 K  
immunization with OVA(323–339) as described above (tolerized). Then, 3 d later, W!"Oho'  
lymphocytes were isolated from the draining lymph nodes of the BALB/c hosts. The 1*e7NJ/.,  
number of cell divisions on CFSE-stained cells and the percentage of cells that had C[';B)a  
undergone a specific number of divisions were determined as described43. Cells were also &7,:: $cu  
stained with mAb KJ1-26 and CFSE analysis of KJ1-26+ T cells was done by flow KF1Zy;  
cytometry. uz I-1@`  
Adenovirus vectors. OrF.wcg  
The cDNA encoding Ras61L was provided by F. Fitch (University of Chicago, Chicago, If]rg+|U  
Illinois). The dominant negative Cbl construct was generated by RT-PCR with cDNA oVr: ZwkG3  
from TH1 clones as a template and the following primers (upper case, restriction enzyme 0|]d^bo  
sequences; underlining, Myc tag sequence): `t\\O  
5'-GGGGTACCatggagcagaaactcatctctgaagaggatctggccggcaacgtgaagaaga-3' (forward) and xSm~V3b c  
5'-ATAGTTTAGCGGCCGCtcaatcttgaggagttggtt cacataa-3' (reverse). The cDNA |&@`~OBa  
encoding DGK- was a gift from M. Topham (University of Utah, Salt Lake City, Utah) i8KoJY"  
and was used as a template to introduce an N-terminal Myc epitope tag by PCR. The WFzM s  
sequences of all PCR products were confirmed before subcloning. Construction of 1JJ1!& >  
recombinant adenovirus vectors was done with a two-cosmid system that has been HRJ\H- V  
described42. N ]14~r=  
Adenoviral transduction of CAR T cells. f~,Ml*Zp  
TH1 clones were purified from passage cultures by Ficoll-Hypaque centrifugation. fq4uiFi<  
Primary CAR 2C Rag2-/- CD8+ T cells were isolated from splenocytes by negative ao0^;  
selection with magnetic beads and antibody 'cocktails' (Stem Cell Technologies). CAR sIbPMu`&U  
TH1 cells were transduced with adenovirus vectors at high cell density (1 107 cells/ml) M]M>z>1*v  
in DMEM containing 2% (volume/volume) FCS and were incubated for 1 h at 37 °C, cs _   
16 s(ap~UCOw  
followed by an overnight 'rest' at 37 °C in DMEM containing 5% (volume/volume) FCS )*R';/zaI  
at low cell density (4 105 cells/ml). ho)JY $#6  
Lentivirus production and infection protocols. V2xvuDHI  
A third-generation lentiviral vector encoding EGFP expressed from the human "LH!Trl@k  
phosphoglycerate kinase promoter was used as described29, 33. Cell populations were = y(*?TZH  
incubated overnight (about 16 h) in X-VIVO-10 medium (BioWhittaker) supplemented I;1)a4Xc4R  
with 1% BSA (Stem Cell Technologies) and L-glutamine (Invitrogen) with viral }D?qj3?bj  
supernatant (multiplicity of infection of 130–180). Viral concentrations of 1.0 108 to 1.8 #qUGc`  
108 viral particles/ml, 2.0 107 to 4.4 107 viral particles/ml and 0.9 108 to 1.6 108 x%O6/rl  
viral particles/ml and cell concentrations of 0.7 106 to 1.1 106 cells/ml, 1.0 105 to 2.5 19-V;F@;  
105 cells/ml and 0.7 106 to 1.4 106 cells/ml for CD34+CD38lo, CD34+CD38- and Lin- C@[U:\  
cord blood, respectively, were maintained. The efficiency of gene transfer was estimated )m[<lJ bw  
by progenitor cell assay as described33. ,KD?kSIf  
Apoptosis induction. Ryygq,>VD.  
Spontaneous apoptosis of PMNs was detected after 22 h of incubation in culture media. >4-9 @i0FV  
In some experiments, zVAD-fmk (10-50 M), TNF (40 ng/ml), resolvin E1–methyl ester, K3UN#G)U  
aspirin-triggered lipoxin A4 analog, PD1–methyl ester (10 nM) or TGF- (10 ng/ml) was 7lA_*t@y  
added. Vehicle treatment was 0.05% (volume/volume) ethanol. Peripheral blood T cells x]`@%8Sm  
were activated by incubation for 3 d in 24-well plates coated with anti-CD3 (5 g/ml; U* c'xoP  
R&D Systems). Jurkat cells or activated peripheral blood T cells were incubated for 4–48 &cJ?mSI  
h with staurosporine (1–2 M) or Fas ligand (0.05–5 ng/ml), after which cells were Lz p}<B  
collected and used for flow cytometry or binding assays. In some experiments, _ WPt zL  
zVAD-fmk (10–50 M; R&D Systems) was added to cells 20 min before the addition of 3:8p="$F  
apoptosis-indu Cz$q"U  
Mice strains and genotyping. O 9o]4;  
The 129/Sv Rhoh-/- mice were generated by Targeting Laboratory. The entire coding !4FOX>|L@  
region of mouse Rhoh is in its third exon; the targeting vector was designed to replace the P,a9B2  
third exon of Rhoh with a neomycin-resistance cassette. The genotypes of Rhoh ^W9O_5\g4a  
gene-targeted embryonic stem cells and transgenic mice were determined by Southern V82I%gPF  
blot analysis of DNA digested with SpeI using a 5' Rhoh genomic DNA probe or by PCR ;UUgqX#  
analysis with primers. The 129/Sv Rhoh-/- mice were crossed with wild-type or p14 TCR {&^PDa|nD  
(V 2V 8) transgenic mice on a C57BL/6J background to generate Rhoh-/- or I"x~ 7  
p14tg/+Rhoh-/- compound mice. Mice used were littermates derived from backcross q8-hbWNm4  
generations with an N of more than 2. The 129S6/SvEvTac-Rag2-/- mice were purchased DpQWh+WRy  
from Taconic Animal Models. All animal experiments were approved by the Institutional ^,t@HN;gA  
Animal Care and Use Committee of the Cincinnati Children's Hospital Research Rg\4#9S JF  
Foundation (Cincinnati, Ohio). \%bJXTK&W  
Antibodies and GST fusion proteins. HC1<zW[  
17 *]h"J]  
Fluorescence-conjugated monoclonal antibodies to the following mouse antigens were :dRC$?f4  
used for flow cytometry: CD4 (RM4-5), CD8 (53-6.7), CD25 (7D4), CD44 (IM7), TCR 0s H~yvM5  
-chain (H57-597), TCR (GL3), TCR V 8, TCR V 5 (MR9-4), CD69 (H1.2F3), CD5 %6rSLBw3  
(53-7.3), Gr-1 (RB6-8C5), Mac-1 (M1-70), NK1.1 (PK136), Thy1.2 (53-2.1), GG<0k\RN  
CD45R–B220 (RA3-6B2), IgM (R6-60.2), BrdU (3D4) and Ter119 (Ly-76; all from Njr;Wa.r+  
Pharmingen). For immunoblot analyses, antibodies to the following were used: RhoH9 kaiK1/W0;  
(B4998), Zap70 phosphorylated at Y319 (17a), phosphorylated tyrosine (4G10) and Lat {X{S[ (|  
(45; Pharmingen); hemagglutinin (3F10; Roche); -actin (AC-15; Sigma); CD3 5/i/. 0?n  
(6B10.2; Santa Cruz Biotechnology); and Lat phosphorylated at Y191 (3584), Zap70 ]h' 38W  
(99F2), phosphorylated p42-p44 (Thr202-Tyr204; 197G2) and p42-p44 (9102; Cell izGU&VeB  
Signaling Technology). Primary antibodies were detected with the secondary antibodies rPyjr(I"_  
horseradish peroxidase–conjugated goat anti-mouse (7076) or goat anti-rabbit (7074; both GYiL}itD=3  
Cell Signaling Technology), or donkey anti-rat (sc-2956; Santa Cruz Biotechnology) Lk@+iHf  
using enhanced chemiluminescence detection (Cell Signaling Technology). GST fusion M*D_p n&  
proteins were expressed in Escherichia coli BL21 (DE3) cells and were purified 8!3q:8y8  
according to the manufacturer's recommendations (GE Healthcare Life Science). Purified _e ;b B?S  
GST fusion protein lysates were incubated for 1 h at 4 °C with glutathione–Sepharose 4B T+zhj ++  
beads. Bead-bound GST fusion proteins were separated by SDS-PAGE and were 5mpql[v3P  
quantified by Coomassie blue staining. 2RF3pIFrm  
GST precipitation assay. f(eXny@Y  
Jurkat cells were lysed in GST lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 ; S$  
mM MgCl2, 1% Nonidet-P40 and Complete Protease Inhibitors). Cell lysates were loaded dTCLE t.  
onto columns of bead-bound GST fusion proteins. After columns were washed with GST kdlmj[=  
lysis buffer containing 150 mM and 200 mM NaCl, bound proteins were eluted with GST 6SE^+@jR  
lysis buffer containing 400 mM NaCl and SDS sample buffer, sequentially. Eluted Lb<IEy77\  
proteins were detected by SDS-PAGE and Coomassie blue staining. Protein bands were ub9[!}r't  
identified with a Bruker Biflex III MALDI-TOF mass spectrometer (SpectroREADER; { pQJ.QI  
Sequenom) and Protein Mass Fingerprinting Mascot search (Matrix Science). D_$N2>I-  
Subcellular fractionation. \b"|p%CL8  
Cells were lysed by brief sonication on ice in a buffer of 250 mM sucrose, 20 mM Tris, !v=/f_6  
pH 7.8, 10 mM MgCl2, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF and Complete ~vA8I#.  
Protease Inhibitors. Lysates were centrifuged to remove nuclei and debris (900g for 5 min sb3z8:r  
at 4 °C). The P100 and S100 fractions were separated by centrifugation for 30 min at IBeorDIZ  
100,000g. Membrane fractions were made soluble with MLB (Upstate) plus protease and bXc*d9]  
phosphatase inhibitors. After centrifugation for additional 30 min at 100,000g, the ^z{Xd|{"  
detergent-insoluble cytoskeleton-containing fraction was resolved by 0.5% SDS-PAGE. }a, ycFt  
Assessment of Intracellular Calcium Concentration /F"eqMN  
评价一下你浏览此帖子的感受

精彩

感动

搞笑

开心

愤怒

无聊

灌水

  
描述
快速回复

验证问题:
免费考博网网址是什么? 正确答案:freekaobo.com
按"Ctrl+Enter"直接提交