加入VIP 上传考博资料 您的流量 增加流量 考博报班 每日签到
   
主题 : 医学SCI 论文经典句子汇编
级别: 中级博友
显示用户信息 
楼主  发表于: 2009-10-18   

医学SCI 论文经典句子汇编

Title l!p`g>$&f  
要求简练,精确 vP{i+s18B  
Compassionate use of bevacizumab (Avastin) in children and young adults with i#:To |\u  
refractory or recurrent solid tumors. y [McdlH m  
Bevacizumab-induced transient remodeling of the vasculature in neuroblastoma rmg\Pa8W>  
xenografts results in improved delivery and efficacy of systemically administered O?vh]o  
chemotherapy. &g?GF\Y  
Proteomics Approaches to the Systems Biology of Cardiovascular Diseases "dpjxH=xO  
Pre- and post-natal treatment of hemophagocytic lymphohistiocytosis. W*LC3B^  
Lack of early bevacizumab-related skeletal radiographic changes in children with J`g5Qn @S  
neuroblastoma. O/eZ1YAC  
Interleukin-4 activates androgen receptor through CBP/p300 4&E"{d >  
Trisomy 8 in an allogeneic stem cell transplant recipient representative of a &S="]*Z  
donor-derived constitutional abnormality.  ]]p\1G  
Disruption of diacylglycerol metabolism impairs the induction of T cell anergy S$b)X"h  
T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase- +  }"+  
High-dose conformal RT improves tumor control in patients with prostate cancer $z!G%PO1%  
Vitamin D concentration does not affect the risk of prostate cancer .]>Tj^1  
Liver resection with salvage transplantation for hepatocellular carcinoma hT^&*}G  
The impact of histopathologic diagnosis on the proper management of testis neoplasms :uYZ1O  
Prostate stem cell antigen is associated with diffuse-type gastric cancer ]{=y8]7  
Multiple myeloma: high-risk immunophenotypes identified B2r[oT R  
Increased c-kit expression predicts poor outcome in acute myeloid leukemia bofI0f}5.  
Global Analysis of the Meiotic Crossover Landscape rQzdHA  
Serum Response Factor Is Required for Sprouting Angiogenesis and Vascular Integrity aH;AGbp  
Integrin Trafficking Regulated by Rab21 Is Necessary for Cytokinesis N:|``n>  
Reduced Translocation of Nascent Prion Protein During ER Stress Contributes to k*_Gg  
Neurodegeneration ^m7y=CJM  
Effects of oral niacin on endothelial dysfunction in patients with coronary artery disease: cPcH 8Vd  
Results of the randomized, double-blind, placebo-controlled INEF study. [ as,AX  
Global experiences with vardenafil in men with erectile dysfunction and underlying 3^KR{N p  
conditions. i7)J|(N2.  
2 (?A c`H  
Noninvasive cardiac imaging: implications for risk assessment in adolescents and young ";dS~(~  
adults. 2lfEJw($  
Transforming growth factor beta1 T29C gene polymorphism and hypertension: '-myOM7  
Relationship with cardiovascular and renal damage. gjsks (x  
A comparison of hormone therapies on the urinary excretion of prostacyclin and -pJ\_u/&%`  
thromboxane A2. ms3"  
Repair of an infected aortic aneurysm using an aortic allograft and a venous autograft: ?9xWTVa8  
Report of a case. (6/aHSXI  
Circulating Leptin and Stress-induced Cardiovascular Activity in Humans. "~ =O`5V  
Effects of aspirin dose on ischaemic events and bleeding after percutaneous coronary `i|!wD,=\  
intervention: insights from the PCI-CURE study. K 91O$'J  
Long-term cardiovascular outcomes following ischemic heart disease in patients with and tJ\v>s-f  
without peripheral vascular disease. t[;-gi,,  
Reduced renal function and sleep-disordered breathing in community-dwelling elderly G5 |nt#>  
men. H|e7IsY%  
Intracoronary pharmacotherapy in the management of coronary microvascular k@9hth2Q  
dysfunction. cY+fZ=  
Inhibition of platelet aggregation by combined therapy with aspirin and cilostazol after 7*K2zu3  
off-pump coronary artery bypass surgery. zA?AX1%Wa  
Inhibition of CCR2 Ameliorates Insulin Resistance and Hepatic Steatosis in db/db Mice s/t,6-~EH  
Abstract 要求简洁,连贯 3rMi:*?  
The acquisition of metastatic ability by tumor cells is considered a late event in the ;>/M al  
evolution of malignant tumors. We report that untransformed mouse mammary cells that 1Z?uT[kR  
have been engineered to express the inducible oncogenic transgenes MYC and KrasD12, or R'1j  
polyoma middle T, and introduced into the systemic circulation of a mouse can bypass ^[R/W VNk  
transformation at the primary site and develop into metastatic pulmonary lesions upon C[{E8Tg/  
immediate or delayed oncogene induction. Therefore, previously untransformed /F^ Jn_  
mammary cells may establish residence in the lung once they have entered the K}N~KDW R|  
bloodstream and may assume malignant growth upon oncogene activation. Mammary OZz/ip-!lc  
cells lacking oncogenic transgenes displayed a similar capacity for long-term residence in 3 QXsr<  
the lungs but did not form ectopic tumors. jZ"j_ =o@  
Almost two decades after CFTR was identified as the gene responsible for cystic fibrosis $mf O:%  
(CF), we still lack answers to many questions about the pathogenesis of the disease, and it 00SS<iX  
remains incurable. Mice with a disrupted CFTR gene have greatly facilitated CF studies, 4K HIUW$  
but the mutant mice do not develop the characteristic manifestations of human CF, <3ep5`1   
including abnormalities of the pancreas, lung, intestine, liver, and other organs. Because Jw;G_dQ[  
pigs share many anatomical and physiological features with humans, we generated pigs ,*9gy$  
with a targeted disruption of both CFTR alleles. Newborn pigs lacking CFTR exhibited !K2QD[x  
defective chloride transport and developed meconium ileus, exocrine pancreatic pKLNBR|  
destruction, and focal biliary cirrhosis, replicating abnormalities seen in newborn humans *>:<  
3 hAds15 %C  
with CF. The pig model may provide opportunities to address persistent questions about x 1 Z'_Qw  
CF pathogenesis and accelerate discovery of strategies for prevention and treatment. RkTYvAk|kY  
Variable lymphocyte receptors (VLRs) rather than antibodies play the primary role in Xwu&K8q21  
recognition of antigens in the adaptive immune system of jawless vertebrates. #Ry Ta /L  
Combinatorial assembly of leucine-rich repeat (LRR) gene segments achieves the {~#PM>f  
required repertoire for antigen recognition. We have determined a crystal structure for a 3A =\Mb  
VLR-antigen complex, VLR RBC36 in complex with the H-antigen trisaccharide from 5-H"{29  
human blood type O erythrocytes, at 1.67 angstrom resolution. RBC36 binds the 0"GLgj:9  
H-trisaccharide on the concave surface of the LRR modules of the solenoid structure Nw"?~"bo  
where three key hydrophilic residues, multiple van der Waals interactions, and the highly egr"og{  
variable insert of the carboxyl-terminal LRR module determine antigen recognition and WlW%z(RC  
specificity. The concave surface assembled from the most highly variable regions of the {,(iL8,^  
LRRs, along with diversity in the sequence and length of the highly variable insert, can Lr d-  
account for the recognition of diverse antigens by VLRs. X f;R'a,$  
A 51-year-old man with a diagnosis of myelodysplasia and non-Hodgkin's lymphoma e7-IqQA{3C  
underwent an unmatched allogenic bone marrow transplantation and was treated Ek_<2!%X  
posttransplant with chronic immunosuppressive medication. Eight months following +!:=Mm  
transplantation, he presented with progressive dysarthria, cognitive and visual decline. 1D!MXYgm1b  
Evaluation included brain magnetic resonance (MR) imaging demonstrating multifocal KW ZEi?  
areas of increased T2 and FLAIR (fluid attenuated inversion recovery) signals involving d0Ubt  
the left frontal, parietal, and occipital lobes. The MR lesions demonstrated diffuse ly_8p63-  
increased signal on DWI (diffusion-weighted images) and normal to low signal on ADC 2AMb-&po&f  
(apparent diffusion coefficients). Contrast-enhanced T1 images were unremarkable. Jk7 Am-.0  
Lumbar puncture revealed a mild elevation in cerebrospinal fluid (CSF) protein. CSF j/NX  
PCR assay for viral DNA fragments were negative on two occasions. Serum serology for VfDa>zV3  
HIV was negative as well. A brain biopsy was subsequently performed. The clinical and *XYp~b  
neuroimaging differential diagnoses as well as neuropathologic correlation are presented. 5}! 36SO\  
In vitro-generated mesenchymal stem cells (MSCs) initially attracted interest for their h qhX  
ability to undergo differentiation toward cells of different lineages. q\gbjci   
These results suggested that xsy45az<ip  
However, there are still obstacles in ,!PV0(F(  
The major challenge for successful drug development is identifying delivery strategies @[f$MRp\  
that can be translated to the clinic. 8TU(5:xJo  
This review will discuss progress in developing and testing small RNAi-based drugs and qzO5p= }  
potential obstacles. WIAukM8~  
This review highlights what a0PU&o1EF  
In addition, there are indications that [f[Wz{Q#Y  
Proper consideration of all of these issues will be necessary in a"t~ K  
These studies provide OQKc_z'"  
This paper presents the potential applications and the hurdles facing anti-HCV siRNA EQw7(r|v:  
drugs. F?cw IE\J  
The present review provides insight into the feasible therapeutic strategies of siRNA c^puz2  
technology, and its potential for silencing genes associated with HCV disease. :)T*:51{#  
4 cnw+^8  
A basic problem in the design of xx is presented by the choice of a xx rate for the S;D]ym  
measurement of experimental variables. 9 HlWoHuC  
This paper examines a new measure of xx in xx based on fuzzy mathematics which \1n (Jr.<  
overcomes the difficulties found in other xx measures. WU@ _aw[  
This paper describes a system for the analysis of the xx. 2dHsM'ze  
The method involves the construction of xx from fuzzy relations. * {~`Lw)y  
The procedure is useful in analyzing how groups reach a decision. q"DHMZB  
The technique used is to employ a newly developed and versatile xx algorithms. >msQ@Ch  
The usefulness of xx is also considered. qK2jJ3)>  
A brief methodology used in xx is discussed. rl$"~/ oz  
The analysis is useful in xx and xx problem. =VT\$ 5A  
A model is developed for a xx analysis using fuzzy matrices. ?U O aqcL  
Algorithms to combine these estimates and produce a xx are presented and justified. ~Eb: AC5  
The use of the method is discussed and an example is given. _g( aO70Zu  
Results of an experimental applications of this xx analysis procedure are given to 1w7XM0SHcn  
illustrate the proposed technique. h+&iWb3;  
This paper analyses problems in BIew\N  
This paper outlines the functions carried out by ... mpVD;)?JmM  
This paper includes an illustration of the ... :PY6J}:&#  
This paper provides an overview and information useful for approaching %X}vuE[[UC  
Emphasis is placed on the construction of a criterion function by which the xx in JRZp 'Ln  
achieving a hierarchical system of objectives are evaluated. !_~ /Y/M  
The main emphasis is placed on the problem of xx @ uN+]e+3  
Our proposed model is verified through experimental study. oOAkwc%)b  
The experimental results reveal interesting examples of fuzzy phases of : xx,xx nm]lPKU+Y  
The compatibility of a project in terms of cost, and xx are likewise represented by pzUr9  
linguistic variables. w Jp1Fl~  
A didactic example is included to illustrate the computational procedure Tp.]{*  
Introduction 引证核心文献,提出假设,指出文章的核心观点 |cp_V   
Beginning @g+v2(f2v  
Over the course of the past 30 years, .. has emerged form intuitive DHuvHK0#  
We evaluated 508 participants who GO@<?>K  
Acute kidney injury (AKI) is associated with an increased incidence of respiratory failure }u$c*}  
requiring mechanical ventilation, which greatly increases mortality >9i>A:   
The cause of respiratory failure in patients with AKI is incompletely understood ~Cw7.NA{3  
However, lung injury also occurs after ischemia–reperfusion injury of other organs such o"z;k3(i$7  
as the liver, gut, and hind limb A: 2CP&*  
We have demonstrated previously that "UhE'\()  
Given this background, we hypothesized that PYs0w6o  
we demonstrate that ?m7i7Dz   
Technological revolutions have recently hit the industrial world { D|ST2:E  
The advent of ... systems for has had a significant impact on the <SOG?Lh~  
5 B]}gfVO  
The development of ... is explored U 0~BcFpD  
The concept of xx was investigated quite intensively in recent years ad47 42  
There has been a turning point in ... methodology in accordance with the advent of ... J kAd3ls  
A major concern in ... today is to continue to improve... =OV5DmVmQ  
It has become increasingly clear that +Zr~mwM=x  
In this paper, we focus on the need for kTT%< e  
This paper proceeds as follow. Y8IC4:EO  
The structure of the paper is as follows. p[At0Gc L  
Our study qdKqc,R1{  
In this paper, we shall first briefly introduce… 5 $$Cav  
To begin with we will provide a brief background on the Q8QB{*4  
This will be followed by a description of the xx of the problem and a detailed $]}K;  
presentation of how the required membership functions are defined. Rbr:Q]zGN  
Details on xx and xx are discussed in later sections. W?P4oKsql*  
Polyphenolic compounds are vasodilators and help to lower the risk of cardiovascular _5(p=Zc  
diseases.  4 x4[  
Taken together, our novel findings suggest that the EDR induced by the strawberry 5M #',(X  
extract was mediated by activation of the PI3 kinase/Akt signaling pathway, resulting in +opym !\  
phosphorylation of eNOS. C"0 VOb  
Objective / Goal / Purpose be]/ROP>H  
The purpose of the inference engine can be outlined as follows: 6-/W4L)?>  
The ultimate goal of the xx system is to allow the non;experts to utilize the existing 6@FhDj2X  
knowledge in the area of manual handling of loads, and to provide intelligent, 5`U zxu  
computer;aided instruction for xxx. )dEcKH<#  
The paper concerns the development of a xx @W @,8e]c  
The scope of this research lies in 4oryTckS  
The main theme of the paper is the application of rule;based decision making. T \ - x3i  
These objectives are to be met with such thoroughness and confidence as to permit ... vSoG] :1  
The objectives of the ... operations study are as follows: )8}k.t>'s  
The primary purpose/consideration/objective of 45< gO1  
The ultimate goal of this concept is to provide oAB:H \  
The main objective of such a ... system is to yENAcsv  
The aim of this paper is to provide methods to construct such probability distribution. \Zx&J.D  
In order to achieve these objectives, an xx must meet the following requirements: gp $Rf9\  
In order to take advantage of their similarity u(f;4`  
more research is still required before final goal of ... can be completed iCh 8e>+  
In this trial, the objective is to generate... S*J\YcqSC  
for the sake of concentrating on ... research issues /Ix5`Q)  
A major goal of this report is to extend the utilization of a recently developed procedure V\r{6-%XiW  
for the xx. $MNJsc^n  
For an illustrative purpose, four well;known OR problems are studied in presence of Q2woCx B  
fuzzy data: xx. 5P\A++2 2Y  
6 gYk5}E-  
This illustration points out the need to specify <u0}&/  
Recent studies have further defined the role of SBP-2 in promoting UGA read-through, ^u"WWLZ  
This concept has been further validated with the discovery of patients with impaired %VR{<{3f  
deiodinase activity due to a mutation in SBP-2 `T7TWv"M  
The ultimate goal is both descriptive and prescriptive. /0 fsn_  
A wealth of information is to be found in the statistics literature, for example, regarding (RG "2I3  
xx wxPl[)E  
This review will focus on the most recent progress achieved in this field, particularly the !io1~GpKS  
cellular and molecular aspects of local control of thyroid hormone signaling provided by ; 8eGf'  
deiodinases. xWK/uE(  
A considerable amount of research has been done .. during the last decade g&EK^q  
A great number of studies report on the treatment of uncertainties associated with xx. qP##C&+#q  
There is considerable amount of literature on planning kZrc^  
However, these studies do not provide much attention to undertainty in xx. +c C. ZOS  
Since then, the subject has been extensively explored and it is still under investigation as vx ' ];  
well in methodological aspects as in concrete applications. GXQ%lQ  
Many research studies have been carried out on this topic. e<a*@ P,  
Problem of xx draw recently more and more attention of system analysis. S+- $Ih`[  
Attempts to resolve this dilemma have resulted in the development of g.%} +5  
Many complex processes unfortunately, do not yield to this design procedure and have, PE/uB,Wl  
therefore, not yet been automated. FeO1%#2<y  
Most of the methods developed so far are deterministic and /or probabilistic in nature. I^u~r.  
The central issue in all these studies is to 9rT^rTV  
The problem of xx has been studied by other investigators, however, these studies have /N<aN9Z<x,  
been based upon classical statistical approaches. >qr/1mW  
Applied ... techniques to N|>JLZ>  
Characterized the ... system as i4h`jFS  
Developed an algorithm to IvY3iRq6  
Developed a system called ... which ~x<?Pj  
Uses an iterative algorithm to deduce n=F rv*"Z  
Emphasized the need to L]!![v.VY  
Identifies six key issues surrounding high technology !!V1#?0jw  
A comprehensive study of the .. has been undertaken (jj`}Qe3U  
Much work has been reported recently in these filed yFb" 2  
Proposed GI,TE  
Presented w%iw xo   
State that +l VA$]d  
Point out that the problem of Yk?q\1  
Described _xm<zy{`S  
Illustrated |%ZJN{!R  
Indicated Q3&D A1b`  
Has shown / showed DC1.f(cdR  
Address =SeQ- H#  
7 jIrfJ*z  
Highlights '\op$t/  
A study on ...was done / developed by [] k+P3z& e  
Previous work, such as [] and [], deal only with [M%? [E}>  
The approach taken by [] is h%W,O,K/  
The system developed by [] consists g}R Cjl4  
A paper relevant to this research was published by [] S(xs;tZ  
[]'s model requires consideration of .. #V]8FW  
[]' model draws attention to evolution in human development >4kQ9lXL  
[]'s model focuses on... N '&>bO?@`  
Little research has been conducted in applying ... to -.M J3  
The published information that is relevant to this research... JeNX5bXW  
This study further shows that pt3)yj&XE  
Their work is based on the principle of WoGnJ0N q  
More history of ... can be found in xx et al. [1979]. O-W[^r2e  
Studies have been completed to established q. Jx|x  
The ...studies indicated that @ %L  
Though application of xx in the filed of xx has proliferated in recent years, effort in Z]TQ+9t  
analyzing xx, especially xx, is lacking. biS[GyQ  
提出Problem / Issue / Question 或假设 c!wRq4  
Unfortunately, real-world engineering problems such as manufacturing planning do not u?MhK# Mr  
fit well with this narrowly defined model. They tend to span broad activities and require 7_qsVhh]$E  
consideration of multiple aspects. CL7 /J[TS  
Remedy / solve / alleviate these problems ^OIo  
It has recently been reported that CVkJMH_  
... is a difficult problem, yet to be adequately resolved G9Q vIXRi  
Two major problems have yet to be addressed 0]'  2i  
An unanswered question aBY&]6^-  
This problem in essence involves using x to obtain a solution. 0Qvr g+  
An additional research issue to be tackled is .... 4 Sk@ v  
Some important issues in developing a ... system are discussed 4f8XO"k7t=  
The three prime issues can be summarized: C Q iHk  
The situation leads to the problem of how to determine the ... lV 4TFt ,  
There have been many attempts to A&v Qtd  
It is expected to be serious barrier to (0LA.aBIf  
It offers a simple solution in a limited domain for a complex problem. O_th/hl  
There are several ways to get around this problem. g +gcH  
As difficult as it seems to be, xx is by no means new. U*sQ5uq  
The problem is to recognize xx from a design representation. L1Yj9i  
A xx problem can trace its roots to xx. !XI9evJw  
xx [1987] used a heuristic approach to simplify the complexity of the problem. sIaehe'B  
Several problems are associated with them. }u0&>k|y  
Although some progress has been made in this area, at least two major obstacles must be _]Ob)RUVH  
overcome before a fully automated system can be realized. 9 yTkZ`M28  
Most problems in practice are complicated $qg2@X.  
More problem surface here. `<<9A\Y-f  
Hamper effort toward a xx system b|kL*{;  
In order to overcome the limitations due to incomplete and imprecise xx knowledge, a xx D^F=:-l m  
program has been developed, which bases its knowledge upon the statistical analysis of a eA?|X|  
sample population of xx $;=?[Cn  
The above difficulties are real challenges faced by researchers attempting to develop p*YV*Arv  
This type of mapping raises no controversy to the issue of membership function AFYdBK]  
determination. NhF"%  
However, attempts to quantify the xx have met both theoretical and empirical problems. gPd ,  
It has become apparent that in order to apply this new methodological framework to O6b+eS  
real;world problems and data, we have to pay attention to the problems of xx and xx. V7gL*,3>=  
MATERIALS AND METHODS ;KmrBNF  
Materials OR|Jc+LT  
Chemicals were purchased from Sigma (St Louis, MO), if not stated otherwise. !lsa5w{  
Experiments were conducted in accordance with the NIH Guidelines for the Care and Use ;tA$ x!5]  
of Laboratory Animals. &><b/,]  
CsA, EGF, PD98059, U0126, AG1478, Wortmannin, and LY294002 were from xy&*s\=:  
Calbiochem (San Diego, CA, USA). Anti-ERK1/2 and anti-Ras were from Transduction ta x:9j|~  
Laboratories (Franklin Lakes, NJ, USA). Anti-phospho Raf-1 (Ser259), anti-phospho *(]ZdB_2  
Raf-1 (Ser338), anti-phospho PKB/Akt (Ser473), anti-PKB, anti-phospho EGFR (Tyr1068), 4sH?8 5=j  
anti-phospho ERK1/2 (Thr202/Tyr204), anti-PI3K 110 , anti-p53, and anti-phospho \xC#Zs[<  
MEK1/2 (Ser217/221) were from Cell Signalling (Danvers, MA, USA). Anti-MEK and u%"5<ll  
anti-Raf-1 (C12) were from Santa Cruz (Santa cruz, CA, USA). Apigenin and all other y )<+?@sP  
reagents were from Sigma (Saint Louis, MO, USA). q%vel.L]%  
Animal P (Y\l  
Eight- to ten-week-old male C57BL/6 mice (wild-type) and IL-6-deficient mice 4N7|LxNNl_  
backcrossed over eight generations on a C57BL/6 background were used WI&}94w  
Mice were maintained on a standard diet and water was made freely available. >/%XP_q%`e  
All experiments were conducted with adherence to the NIH Guide for the Care and Use c_.Fe'E  
of Laboratory Animals. mC(YO y  
The animal protocol was approved by the Animal Care and Use Committee of the aZtM _  
University of Colorado UL%a^' hR  
Three surgical procedures were performed as described previously:5 (1) sham operation, `@0AGSzUv  
(2) ischemic AKI, and (3) bilateral nephrectomy. hK{<&T  
The abdomen was closed in one layer. u'DpZ  
Sham surgery consisted of the same procedure except that clamps were not applied. 1O,8=,K2a  
9 37jrWe6xwp  
For bilateral nephrectomy, renal pedicles were tied off with suture and then cut distally. 7i#/eRui  
The ureters were pinched off with forceps and the kidneys removed. } *qj,8-9  
Serum was collected as described previously.5 Blood urea nitrogen and creatinine were qss )5a/x.  
measured using an autoanalyzer (Beckman Instruments, Fullerton, CA, USA). :l iDoGDi  
Serum IL-6 was measured by ELISA according to assay instructions (R&D Systems, C[#C/@  
Minneapolis, MN, USA). tB(~:"|8  
Five-micrometer sections of paraffin-embedded lung tissue were stained with )DlKeiK  
hematoxylin and eosin using standard protocols. Neutrophils were counted on the basis of L$kB(Brw  
morphological criteria; at least 50 high-powered fields ( 40) were counted per slide. H?xY S| n  
Frozen lung was prepared for ELISA as described previously.5 Supernatants were =]"I0G-s!  
analyzed for protein content using a Bio-Rad DC protein assay kit (Hercules, CA, USA). WNQ<XB qAw  
KC and MIP-2 were determined by ELISA (R&D Systems, Minneapolis, MN, USA). S QGYH  
One-fourth lung was used to determine MPO activity as described previously. n"Bc2}{  
Frozen lung was homogenized in radioimmunoprecipitation assay buffer with protease I:UDEoQo  
inhibitor; western blotting was performed as described previously.49 Goat anti-murine _z 5W*..  
ICAM-1 polyclonal antibody (R&D Systems, Minneapolis, MN, USA; 1:2000) or rat Y| ch ;  
anti-murine VCAM-1 monoclonal antibody (R&D Systems; 1:1000) were used. jcBZ#|B7;  
A total of 20 g anti-IL-6 antibody vs IgG control (eBioscience, San Diego, CA, USA) /m 7~-~$V  
was administered to wild-type mice by tail vein injection 1 h before surgery, Eciu^  
intraperitoneally at the time of clamp removal (ischemic AKI) or nephrectomy (bilateral LGX+_ "  
nephrectomy) and intraperitoneally 1 h following surgery (60 g total). ~(GN Y 5  
Experimental groups &`tAQN*Z  
STZ-induced diabetic rats, a model of partial type I diabetes: SD rats received a single KNj~7aTp  
intraperitoneal injection of freshly prepared STZ (65 mg kg-1 body weight, dissolved in N>]J$[j  
100 mmol l-1 citric acid, pH 4.5), and confirmed 2 days later by PP blood glucose \^RKb-6n  
(>250 mg dl-1). G'(rjH>q  
CTR rats: Vehicle-injected SD rats after 2 to 7 days, 14 to 30 days, and 90 days served as CXyb8z4/+  
CTR for the 2 and 7 days STZ, the 14 and 30 days STZ, and for the 90 days STZ, 4i^WE;|s  
respectively. NuD|%Ebs  
Insulin treatment in STZ: Glc was normalized in seven animals during 12–14 days of $ &KkZ  
STZ by subcutaneous insulin implants (2U day-1; Lin Shin Canada, Ontario, Canada). mdEl CC0  
Cell Culture DrC"M*$!  
Immortalized cells from the convoluted portion of mouse kidney proximal tubule yTZ o4c "  
PKSV-PCT cells (PCT3 clone) were cultured in a medium A (DMEM/Ham's F12 (1:1, Q[K)Yd  
v/v), 20 mM HEPES, 2 mM L-glutamine, 12.5 mM D-glucose, 60 nM sodium selenite, Q>rr?L`  
5 g ml-1 transferrin, 50 nM dexamethasone, 100 U ml-1 penicillin, and 100 g ml-1 0 _MtmmL.  
streptomycin), supplemented with 2% fetal bovine serum, 5 g ml-1 insulin, 10 ng ml-1 a_?b <  
EGF, and 1 nM triiodothyronine at 37°C in a 95:5 air/CO2 water-saturated atmosphere. : T7(sf*!*  
For all experiments, cells were seeded at 0.2 106 cells/ml and after 24 h with complete Qx8(w"k*  
medium cells were starved for 16 h in medium A supplemented with 0.1% fetal bovine i.`n^R;N  
10 HTGLFY(&  
serum but not insulin, EGF, or triiodothyronine. CsA was dissolved in ethanol and all the `8RKpZv&  
pharmacological inhibitors were in DMSO. In all cases, controls were carried out with zp<B,Ls  
cells treated with the corresponding vehicle alone. After treatments, cells were washed LyWY\K a  
twice with cold phosphate-buffered saline (PBS) and harvested with lysis buffer as in !Hl]&  
Llorens et al ci$ J?a  
Cell viability X:;x5'|  
After treatments, PCT3 cells were harvested and washed twice with cold PBS, and the -C3[:g  
viable cells were counted with Trypan Blue Dye (Gibco-Life Technologies, Grand Island, NlKVl~_ C  
NY, USA) in a Neubauer chamber. Living cells exclude the dye, whereas dead cells will gD4vV'|  
take up the blue dye. For Hoechst staining, cells seeded in six-well dishes were washed 4"(rZWv  
twice with PBS and fixed for 15 min with 4% paraformaldehyde at room temperature. ,qv\Y]  
Then, cells were washed twice again with PBS and stained with Hoescht (5 g ml-1 in &0-oi Y  
PBS) for 5 min. ~"SQwE|  
Western blots/ Immunoblot AD?XJ3  
The protein content of cellular extracts was quantified by the Bradford assay.44 2bG3&G  
Twenty-five microgram of total cell extract protein was run on SDS-polyacrylamide gel W&%,XwkQ  
electrophoresis gels, transferred onto polyvinylidene difluoride membranes, and PS+~JwDUc  
incubated with the corresponding antibodies. The membranes were developed with the *URT-+'  
enhanced chemiluminescence method (Pierce, Rockford, IL, USA). m} s.a.x  
Supernatants of growing or growth-arrested cells were centrifugated for 5 min at 10 000 g. jga\Ry=nw  
The cells were lysed as described. The proteins from supernatant and cell lysates were ;(Ug]U%3_  
concentrated using heparin sepharose. The heparin sepharose was washed four times with BO G.[?yx  
phosphate-buffered saline containing protease inhibitors, dissolved in phosphate-buffered |. 0~'  
saline/protease inhibitor and incubated with 500 g protein over night at 4°C. The ~U"m"zpLP  
complexes were washed with phosphate-buffered saline/protease inhibitor and the -kMw[Y  
proteins were eluated with 100 l Laemmli buffer without bromophenol blue (10 min 4Zwbu  
95°C). A 30 l probe was loaded in each lane and western blot analysis was performed as *?HGi>]\ |  
described, using a polyclonal antibody against CCN3 (K19M), which recognizes a D^US2B  
C-terminal 19-aminoacid peptide of human CCN3. As a positive control, a supernatant nf 8V:y4  
from adrenocortical cell cultures, which are known to secrete CCN3, was used. PD.$a-t  
Cells were lysed in 0.5% (volume/volume) Triton X-100 lysis buffer and immunoblot QDQ"Sc06  
analysis was done as described43. Immunoprecipitation with anti-CrkL or control rabbit gI;"PkN  
antiserum was done as described44. Antibodies to the following were used: =N\; ?eF(  
phosphorylated Erk (910L; Cell Signaling); phosphorylated Jnk (V7932; Promega); Erk lsOv#X-b E  
(13-6200; Zymed); Jnk1 (sc-474), H-Ras (sc-35), C3G (sc-869), CrkL (sc-319), bN zb#P#hP  
RasGRP1 (sc-8430) and DGK- (sc-8722; all from Santa Cruz Biotechnologies); and _Ik?WA_;  
DGK- (a gift from H. Kanoh, Sapporo Medical University, Sapporo, Japan). Images yT@Aj;X0v  
were scanned, followed by densitometry analysis with UN-SCAN-IT software (Silk iv *$!\Cd  
Scientific). /h+ W L  
11 ]wU/yc)e  
Purified splenic T cells were stimulated for various times with 5 g/ml of anti-CD3 O?Bf (y  
(500A2; BD Pharmingen) and were lysed in 1% Nonidet P-40 lysis buffer (1% ?o;ip  
(volume/volume) Nonidet-40, 150 mM NaCl and 50 mM Tris, pH 7.4) with protease [8sYEh  
inhibitors. Proteins were resolved by SDS-PAGE and were transferred to a Trans-Blot 1#,4P1"  
Nitrocellulose membrane (Bio-Rad Laboratories); membranes were probed with L?d?O  
antibodies specific to phosphorylated Erk (91015; Cell Signal Technology) and vu*e*b$}  
phospholipase C- 1 (05-163; Upstate Biotechnology). Membranes were stripped and iF^qbh%%E  
were reprobed for analysis of total Erk (SC-16982; Santa Cruz Biotechnology). Activated |gO7`F2  
Ras in cell lysates was determined by glutathione S-transferase–Raf—Ras-binding cj>UxU][eS  
domain precipitation assay as described rwLKY .J]  
Immunofluorescence microscopy. 0>BxS9?w  
Analysis of protein localization in 2C T cell–P815.B71 cell conjugates was done as @^UgdD,BS,  
described29. P815.B71 cells were labeled with CMAC (7-amino-4-chloromethylcoumarin) $C7a #?YF,  
Cell-Tracker Blue (Molecular Probes) and were mixed with equal numbers of anergic or Ra|P5  
in vitro–primed 2C Rag2-/- T cells. After approximately 8 min, cells were fixed, were %(W&(eN  
made permeable and were stained with anti-GRP1 and anti-talin (Santa Cruz {k3ItGQ_  
Biotechnologies) and with species-specific secondary antibodies conjugated to .8|wc  
fluorescein isothiocyanate or phycoerythrin, respectively. Samples were analyzed with a paIjXaU1Mb  
Zeiss Axiovert 100 microscope, and 15 conjugates were typically assigned scores. ,yGbMOV  
Slidebook software (Intelligent Imaging Innovations) was used for image capture and q!:dZES  
deconvolution analysis. ImageJ 1.36b software (US National Institutes of Health) was R BHDfm'~7  
used for quantification of pixel intensity. 9Y.(xp &vw  
Measurement of ROS generation 0 MK}  
The assay is based on the incorporation of 2',7'-dichlorofluorescein diacetate into the cell. ^H.B6h?  
H2O2 and peroxidases are able to oxidize the cleaved DCFH to DCF, which is highly q* R}yt5  
fluorescent at 530 nm. To measure CsA-induced ROS generation, cells were washed `#ruZM066  
twice with PBS, and fresh medium containing 20 M 2',7'-dichlorofluorescein diacetate x;7l>uR  
was added to previously treated cells. After 30 min cells were washed again, tripsinized, T5u71C_wmt  
and resuspended with cold PBS. Fluorescence was measure by flow cytometry on a xkDK5&V  
FACScan flow cytometer. JI .=y5I  
Raf-1 activity H}kZ;8  
Raf-1 immunoprecipitation and kinase assay were performed as described previously.45 nm1dd{U6^  
Immunoprecipitated Raf was incubated for 30 min at 30°C with 0.8 mM ATP, 10 g ml-1 y{@\8B]  
GST-MEK, and 100 g ml-1 GST-ERK2. An aliquot of the supernatant was used for `Jc/ o=]  
ERK2 activity assays using 0.5 mg ml-1 myelin basic protein and 0.1 mM [ -32P] ATP P$U" y/  
(400 c.p.m. pmol-1). After 15 min incubation at 30°C, 12 l of 5 Laemmli loading Wz' !stcp  
buffer was added to the tubes and the mixture analyzed by SDS-polyacrylamide gel =\.*CY|;N  
electrophoresis. Radiolabeled bands were quantified in a PhosphoImager. V gMgeja  
12 j2Dw7"f3  
Semiquantitative RT-PCR. \+V"JIStUj  
Total RNA was isolated from freshly isolated thymocytes. Then, cDNA was prepared I*N"_uKU  
with the M-MuLV reverse transcriptase and random primers according to the vQ*[tp#qU  
manufacturer's recommendations (New England Biolabs). Semiquantitative PCR analysis )9`HO?   
of Tcrb VDJC (where 'C' is the constant region) and Cd3e cDNA was done as described51. u"qVT9C$=  
[32P]dCTP (GE Healthcare Life Science) was incorporated into PCR products for X~jdOaq{F:  
semiquantitative detection by autoradiography. b$DiDm  
Real-time quantitative RT-PCR d2UidDU5qa  
Total RNA was isolated from HMC or rat mesangial cells using the Invisorb Spin P_5aHeiJ  
Cell-RNA Mini Kit (Invitek, Berlin, Germany) or from isolated glomeruli using the jl P*RX  
RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA purity determination, cDNA INr1bAe$  
synthesis, and RT-PCR were performed as described.16 Primer sequences are listed in 44*#qLN  
Table 2. Glyceraldehyde-3-phosphate dehydrogenase cDNA amplification was used as an :o8`2Z*g  
internal standard. xJ$uoy3+  
Total RNA was isolated from the frozen kidneys as described by Chomczynski and N] sbI)Z@  
Sacchi47 and quantified by a photometer. One microgram of the resulting RNA was used Y|LL]@Lv  
for reverse transcriptase (RT)-PCR. The cDNA was synthesized by MMLV reverse f` Fj-<v  
transcriptase (Superscript-Invitrogen, Carlsbad, CA, USA). For quantification of renin u"qu!EY2  
mRNA expression (sense: 5'-ATGAAGGGGGTGTCTGTGGGGTC-3', antisense: eV*QUjS~  
5'-ATGCGGGGAGGGTGGGCACCTG-3'), real-time RT-PCR was performed using a A.r7 ks  
Light Cycler Instrument (Roche Diagnostics Corp., Basel, Suisse) and the QuantiTect I4N7wnBp  
SYBR Green PCR kit (Qiagen, Hilden, Germany), with GAPDH (sense: 5&s6(?,Eu  
5'-TTCATTGACCTCAACTACAT-3', antisense: 5'-GAGGGGCCATCCACAGTCTT-3') $^fF}y6N  
as a control. PCR was run for 30 cycles with 15 s per 95°C denaturation, 20 s/58°C "]=OR>  
annealing and 20 s/72°C elongation. To verify the accuracy of the amplicon, a melting v,}C~L3  
curve analysis was done after amplification.Total renin mRNA content per kidney was 4N,[Gs<7  
calculated from the yield of RNA extracted from the whole kidneys times the renin I]eeV+U8W  
mRNA estimate obtained from the defined amount of RNA used for RT-PCR real time {nmu(E P  
measurement. For the RT-PCR real-time measurements, a pool of RNA from adult mouse v>LK+|U  
kidneys was generated, which served as standard for all RT-PCR runs. Thus, all renin l!:bNMd  
mRNA levels for the developing kidneys were estimated relative to the levels in adult [ ojL9.6  
kidneys. }BM`4/  
In vitro anergy assay. IQ<G .  
Wild-type, Dgka-/- and Dgkz-/- splenocytes were stained with 5 M CFSE, were TQO|C?  
stimulated for 72 h with anti-CD3 (1 g/ml; 2C11) along with CTLA-4–Fc (5 g/ml), ZOfv\(iJ;  
were stained with allophycocyanin-conjugated anti-CD4 and were analyzed by flow sX6\AYF1M  
cytometry. Cell division was assessed by CFSE dilution after gating on live CD4+ cells. lx2#C9L_  
Alternatively, cells were stimulated for 72 h and were pulsed with 1 Ci/well of o`n8Fk}i  
[3H]thymidine for the final 8 h of stimulation, and proliferation was assessed by tritium nX:E(9q7c  
incorporation with a scintillation counter. For restimulation analyses, cells were  ="]r{  
13 YMu#<ZG  
prestimulated with anti-CD3 plus CTLA-4–Fc, then after 72 h, CD4+ cells were purified ^*l dsc  
by negative selection (with fluorescein isothiocyanate–conjugated anti-CD8, anti-B220 BaIpX<$T  
(RA3-6B2; BD Pharmingen), anti-DX5 and anti-CD11b (M1/70; BD Pharmingen), G)~>d/  
followed by depletion with anti–fluorescein isothiocyanate magnetic beads) and were Pa{DB?P  
allowed to 'rest' overnight at 37 °C. Live cells were then counted by Trypan blue Ru`afjc  
exclusion, and equivalent numbers of live cells were dropped onto monolayers of bone CL2zZk{u_  
marrow–derived macrophages coated with anti-CD3 (1 g/ml) and anti-CD28 (0.5 ~Zsj@d  
g/ml). After 24 h, supernatants were collected and IL-2 was quantified by ELISA D>jtz2y=D  
according to the manufacturer's protocol (R&D Systems). x=rMjz-`_  
Three-dimensional reconstruction P4"BX*x  
Serial sections of kidney specimens were fixed and stained for renin and for SMA as 7Q{&L#;  
described above. Digitalization of the serial slices was performed using an AxioCam j6^.Q/{^  
MRm camera (Zeiss, Jena, Germany) mounted on an Axiovert200M microscope (Zeiss) w@2NXcmw  
with fluorescence filters for renin and SMA (TRITC: filter set 43: Cy2: filter set 38 HE; qDG x (d  
Zeiss). After acquisition, a stack of equal-sized images was built using the graphic tool 0UpRSh)#  
ImageJ (Wayne Rasband, NIH, Bethesda, MD, USA). The equalized data were then +xIVlH9`Q  
imported into the Amira 4.1 visualization software (Mercury Computer Systems Inc., VB/75xK_  
Chelmsford, MA, USA) on a Dell Precision 690 computer system (Dell, Frankfurt, "T /$K  
Germany), and subsequently split into the renin and SMA channels. After this step, the N@0/=B[n  
renin and SMA channels were aligned. In the segmentation step, the SMA and renin i8Be%y%y  
data sets served as a scaffold and were spanned manually or automatically using wIRU!lIF9  
grayscale values. Matrixes, volume surfaces, and statistics were generated from these ?_{{iil  
segments.   XU"G  
Restimulation assay after in vivo immunization. L7 FFa:#  
For analysis of T cell priming in vivo, CD4+ T cells were collected from naive, primed or _Iy)p{y  
tolerized recipient mice on day 15 after immunization. Proliferative responses were 71(ppsHk  
measured by culture for 72 h of CD4+ T cells (3 106 cells/ml) with irradiated (3,000 rads) ax _v+v %  
APCs (10 106 cells/ml) and OVA(323–339). The number of KJ1-26+ cells for each D_F1<q  
group of recipient mice was determined by flow cytometry and proliferation was E\4ZUGy0  
normalized to the number of input KJ1-26+ cells. Supernatants were collected from plates &Kc45  
and cytokine concentrations were measured by ELISA. %[*_-%  
Flow cytometry. A5fzyG   
For analysis of surface antigen expression, mAb to CD4 (JK1.5; eBioscience) and mAb }nM+"(}  
KJ1-26 (KJ-126; Caltag) were used. For intracellular IL-2 staining, T cells were toG- Dz&  
restimulated for 24 h in vitro with OVA(323–339) in the presence of APCs as described Or/YEt}  
above. Brefeldin A (eBioscience) was added for the last 6 h of the culture. Cells were 4nd)*0{ f  
collected and were stained with allophycocyanin-conjugated mAb to CD4 and fluorescein =*(_sW6;  
isothiocyanate–conjugated mAb KJ1-26. Then, cells were fixed, were made permeable &_QD1 TT  
and were stained with antibody to IL-2 (clone JES6-5H4; eBioscience) according to the 29@m:=-}7  
manufacturer's instructions. Ki :98a$  
14 ( F R  
TH1 cells transduced with adenovirus vector encoding GFP were analyzed with a J=t}N+:F`b  
FACScan (BD Biosciences). A total of 1 104 events were acquired, and data were nm|"9|/  
analyzed with CellQuest software (BD Biosciences). #)DDQ?D  
Splenic and lymph node samples depleted of thymocytes and red blood cells were stained 0}_ 1 ZU  
with fluorescence-conjugated anti-CD3 (2C11), anti-CD4 (GK15), anti-CD8 (53-6.7), BW`Tw^j  
anti-CD25 (7D4) and anti-CD44 (552407; all from BD Pharmingen). A three-color ]nS9taEA   
FACScan (Becton Dickinson) was used for flow cytometry, and data were analyzed with pkIJbI{aS  
FlowJo 4.6 (TreeStar). wuqB['3  
A FACSCalibur (Becton Dickinson) was used for flow cytometry. Human cells from z[+pN:47  
transplanted NOD-SCID mice were assessed with phycoerythrin–cyanin 5–conjugated d$D3iv^hyx  
anti–human CD45 and phycoerythrin-conjugated anti-CD19, anti-CD33, anti-CD36 and "y .(E7 6  
anti–glycophorin A (Becton Dickinson). EGFP fluorescence was detected with channel a^L'-(  
FL1 calibrated to the fluorescein isothiocyanate emission profile. During quadrant n QOLR? %  
analysis, only fluorescence excluding more than 99% of isotypic control events was U,2\ TBz  
considered specific. Cell Quest Pro software (Becton Dickinson) and FlowJo (Tree Star) {M0pq3SL*t  
were used for data acquisition and analysis. sgeME^v  
Mammalian expression plasmids and transfection. f;W>:`'  
For generation of the plasmid expressing Smad3 shRNA, the following specific y-7$HWn  
oligonucleotides were used: upper, j98>Jr\  
5'-GATCCACCTGAGTGAAGATGGAGATTCAAGAGATCTCCATCTTCACTCAGG L_YY,  
TTTTTTTACGCGTG-3'; lower, FU(s jB  
3'-AATTCACGCGTAAAAAAACCTGAGTGAAGATGGAGATCTCTTGAATCTCCA ZsDn`8  
TCTTCACTCAGGTG-5'. These were cloned under control of the U6 promoter into the X?]1/6rV  
pSIREN-DNR-DsRed expression vector (Clontech, BD). Vector expressing shRNA <7~+ehu  
specific for luciferase served as a control. Smad3-Tm was subcloned into the O7Awti-X  
pIRES2-EGFP vector (Clontech, BD); empty vector served as a control. Purified DvXbbhp  
DO11.10 or DO11.10p27 T cells were transfected with plasmids by nucleofection with gcs8Gl2  
the Amaxa nucleofection apparatus, according to the manufacturer's instructions (Mouse !*|`-w oE  
T Cell Nucleofector Kit Amaxa Biosytems). Purified T cells were suspended in sJ/?R:  
nucleofector solution (3 106 cells/100 l) and were mixed with 3 g of plasmid. n&uD=-  
Samples were transferred into cuvettes, were transfected with nucleofector program X-01 k*xgF[T 8  
and were then immediately transferred into 12-well plates and were cultured in 4#@zn 2l  
nucleofector medium for 3 h. Then, cells were collected and counted and were 2f@gR9T  
immediately transferred into syngeneic recipient mice (3 106 cells per mouse). At 3 h HveOG$pT  
after adoptive transfer, mice were given priming or tolerizing treatment in vivo according  ^'c[HVJ  
to the standard protocol described above. Lymphocytes were isolated from draining KGb3n;]  
lymph nodes at day 5 of the treatment, CD4+ T cells were purified and transfection  k@ZmI^  
efficiency was assessed by flow cytometry. The range of transfection efficiency was O>`D R0  
69–75% (Supplementary Fig. 4 online). Smad3-knockdown and control-knockdown "#mr?h_  
DO11.10 cells and DO11.10 cells transfected with Smad3-Tm and vector control were ZMXIKN9BF#  
selected by cell sorting. The resulting CD4+ T cells (2 106 cells/ml) were restimulated VDq?,4Kb  
with OVA(323–339) (5 g/ml) in the presence of irradiated APCs in vitro. $n?@zd@53  
15 ]\<^rEU  
Luciferase assays. "+V.Yue`R  
CAR IL-2–Luc TH1 clones were transduced with vectors, were stimulated for 20 h and jDO[u!J6.%  
were resuspended in serum-free DMEM in luminometer cuvettes (BD Biosciences). An *L.+w-g&&  
equal volume of Bright-Glo luciferase assay reagent (Promega) was added to each sample, ;  u0 MY  
followed by thorough mixing. After 2 min, samples were analyzed with a monolight 2010 }l>0m  
Luminometer (BD Biosciences). Q<V?rPAcx  
Analysis of cell divisions in vivo. kMz^37IFMG  
Purified T cells from DO11.10 and DO11.10p27 mice (10 106 cells/ml) were labeled Zg/ra1n  
for 30 min at 37 °C with the intracellular fluorescent dye CFSE (5 M 5(and 4b B)t#  
6)-carboxyfluorescein succunimidyl ester; Molecular Probes). Then, cells were washed -%lA=pS{Fq  
twice with cold RPMI 1640 medium containing 10% FCS, were resuspended in PBS and }Q?, O  
were transferred intravenously into BALB/c mice (5 106 cells per mouse). Syngeneic s1xl*lKX%  
hosts were left untreated (naive) or were treated with PBS followed by immunization #B3P3\  
with OVA(323–339) (primed) or with CTLA-4–Ig plus mAb to CD40L followed by |P si?'4  
immunization with OVA(323–339) as described above (tolerized). Then, 3 d later, r9Wk7?w)  
lymphocytes were isolated from the draining lymph nodes of the BALB/c hosts. The `r:n[N=Y&  
number of cell divisions on CFSE-stained cells and the percentage of cells that had 0m^(|=N-  
undergone a specific number of divisions were determined as described43. Cells were also 8(e uWS  
stained with mAb KJ1-26 and CFSE analysis of KJ1-26+ T cells was done by flow B6&;nU>;  
cytometry. oZkjg3  
Adenovirus vectors. OsMU>v }m  
The cDNA encoding Ras61L was provided by F. Fitch (University of Chicago, Chicago, >weY_%a  
Illinois). The dominant negative Cbl construct was generated by RT-PCR with cDNA +pcpb)VL  
from TH1 clones as a template and the following primers (upper case, restriction enzyme h|tdK;)  
sequences; underlining, Myc tag sequence): VL5GX (  
5'-GGGGTACCatggagcagaaactcatctctgaagaggatctggccggcaacgtgaagaaga-3' (forward) and x t7ZrT  
5'-ATAGTTTAGCGGCCGCtcaatcttgaggagttggtt cacataa-3' (reverse). The cDNA /*)zQ?N  
encoding DGK- was a gift from M. Topham (University of Utah, Salt Lake City, Utah) K ErQCBeJ  
and was used as a template to introduce an N-terminal Myc epitope tag by PCR. The 2HNKq<  
sequences of all PCR products were confirmed before subcloning. Construction of )_eEM1  
recombinant adenovirus vectors was done with a two-cosmid system that has been 2 5DXJ b^:  
described42. zrqQcnx9(m  
Adenoviral transduction of CAR T cells. 18ApHp  
TH1 clones were purified from passage cultures by Ficoll-Hypaque centrifugation. 3":vjDq$  
Primary CAR 2C Rag2-/- CD8+ T cells were isolated from splenocytes by negative #1-,s.)  
selection with magnetic beads and antibody 'cocktails' (Stem Cell Technologies). CAR /UP&TyZ  
TH1 cells were transduced with adenovirus vectors at high cell density (1 107 cells/ml) )YE3n-~7{  
in DMEM containing 2% (volume/volume) FCS and were incubated for 1 h at 37 °C, A}Q6DHh26  
16 o gec6u}  
followed by an overnight 'rest' at 37 °C in DMEM containing 5% (volume/volume) FCS hXBAs*4DV8  
at low cell density (4 105 cells/ml). Ah5`Cnv  
Lentivirus production and infection protocols. {t<E*5N]a  
A third-generation lentiviral vector encoding EGFP expressed from the human ws1io.  
phosphoglycerate kinase promoter was used as described29, 33. Cell populations were #aX+?z\4  
incubated overnight (about 16 h) in X-VIVO-10 medium (BioWhittaker) supplemented w;@NYMK)  
with 1% BSA (Stem Cell Technologies) and L-glutamine (Invitrogen) with viral P%VEJ5,]b  
supernatant (multiplicity of infection of 130–180). Viral concentrations of 1.0 108 to 1.8 hk6(y?#  
108 viral particles/ml, 2.0 107 to 4.4 107 viral particles/ml and 0.9 108 to 1.6 108 w; [ndZCY7  
viral particles/ml and cell concentrations of 0.7 106 to 1.1 106 cells/ml, 1.0 105 to 2.5 ?VUU[h8"v5  
105 cells/ml and 0.7 106 to 1.4 106 cells/ml for CD34+CD38lo, CD34+CD38- and Lin- d}@b 3   
cord blood, respectively, were maintained. The efficiency of gene transfer was estimated Rcg q7W  
by progenitor cell assay as described33. 8DAHaS;  
Apoptosis induction. j)G<PW  
Spontaneous apoptosis of PMNs was detected after 22 h of incubation in culture media. ~e|RVY,  
In some experiments, zVAD-fmk (10-50 M), TNF (40 ng/ml), resolvin E1–methyl ester, Db:^Omw o  
aspirin-triggered lipoxin A4 analog, PD1–methyl ester (10 nM) or TGF- (10 ng/ml) was 5;WESk  
added. Vehicle treatment was 0.05% (volume/volume) ethanol. Peripheral blood T cells <}uhKp>*  
were activated by incubation for 3 d in 24-well plates coated with anti-CD3 (5 g/ml; >:o$h2  
R&D Systems). Jurkat cells or activated peripheral blood T cells were incubated for 4–48 voX4A p l  
h with staurosporine (1–2 M) or Fas ligand (0.05–5 ng/ml), after which cells were t QR qQ  
collected and used for flow cytometry or binding assays. In some experiments, qQ&=Z` p!  
zVAD-fmk (10–50 M; R&D Systems) was added to cells 20 min before the addition of d- X6yRjnj  
apoptosis-indu ~F [V  
Mice strains and genotyping. "SMRvi57T  
The 129/Sv Rhoh-/- mice were generated by Targeting Laboratory. The entire coding t=l@(%O 0_  
region of mouse Rhoh is in its third exon; the targeting vector was designed to replace the o#Gf7.E8  
third exon of Rhoh with a neomycin-resistance cassette. The genotypes of Rhoh D02'P{  
gene-targeted embryonic stem cells and transgenic mice were determined by Southern hwx1fpo4  
blot analysis of DNA digested with SpeI using a 5' Rhoh genomic DNA probe or by PCR ^X]rF Y1  
analysis with primers. The 129/Sv Rhoh-/- mice were crossed with wild-type or p14 TCR *A&A V||q  
(V 2V 8) transgenic mice on a C57BL/6J background to generate Rhoh-/- or wI5(`_l{G  
p14tg/+Rhoh-/- compound mice. Mice used were littermates derived from backcross h5)4Z^n  
generations with an N of more than 2. The 129S6/SvEvTac-Rag2-/- mice were purchased K#%@4]jO3  
from Taconic Animal Models. All animal experiments were approved by the Institutional q1^bH 6*fl  
Animal Care and Use Committee of the Cincinnati Children's Hospital Research X- 4(oE  
Foundation (Cincinnati, Ohio). O#_\@f#[  
Antibodies and GST fusion proteins. y&n-8L_  
17 iFOa9!_0n  
Fluorescence-conjugated monoclonal antibodies to the following mouse antigens were WJlJD*3  
used for flow cytometry: CD4 (RM4-5), CD8 (53-6.7), CD25 (7D4), CD44 (IM7), TCR 8l>7=~Egp  
-chain (H57-597), TCR (GL3), TCR V 8, TCR V 5 (MR9-4), CD69 (H1.2F3), CD5 ~0@ uR  
(53-7.3), Gr-1 (RB6-8C5), Mac-1 (M1-70), NK1.1 (PK136), Thy1.2 (53-2.1), $6l^::U  
CD45R–B220 (RA3-6B2), IgM (R6-60.2), BrdU (3D4) and Ter119 (Ly-76; all from `_iK`^(-  
Pharmingen). For immunoblot analyses, antibodies to the following were used: RhoH9 !#Pr'm/,mu  
(B4998), Zap70 phosphorylated at Y319 (17a), phosphorylated tyrosine (4G10) and Lat YB+My~fw{l  
(45; Pharmingen); hemagglutinin (3F10; Roche); -actin (AC-15; Sigma); CD3 [-0=ZKH?  
(6B10.2; Santa Cruz Biotechnology); and Lat phosphorylated at Y191 (3584), Zap70 "8$Muwm  
(99F2), phosphorylated p42-p44 (Thr202-Tyr204; 197G2) and p42-p44 (9102; Cell )%JjV(:  
Signaling Technology). Primary antibodies were detected with the secondary antibodies FrsXLUY  
horseradish peroxidase–conjugated goat anti-mouse (7076) or goat anti-rabbit (7074; both :IX_|8e ^  
Cell Signaling Technology), or donkey anti-rat (sc-2956; Santa Cruz Biotechnology)  \4j(el  
using enhanced chemiluminescence detection (Cell Signaling Technology). GST fusion \nUJ)w  
proteins were expressed in Escherichia coli BL21 (DE3) cells and were purified ;uho.)%N`F  
according to the manufacturer's recommendations (GE Healthcare Life Science). Purified #[&9~za'"m  
GST fusion protein lysates were incubated for 1 h at 4 °C with glutathione–Sepharose 4B Bdcs}Ga  
beads. Bead-bound GST fusion proteins were separated by SDS-PAGE and were yR% l[/ X  
quantified by Coomassie blue staining. l(pP*2  
GST precipitation assay. 5FVmk5z]d  
Jurkat cells were lysed in GST lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 ~bq w!rz  
mM MgCl2, 1% Nonidet-P40 and Complete Protease Inhibitors). Cell lysates were loaded ~#dfZa&   
onto columns of bead-bound GST fusion proteins. After columns were washed with GST ?X+PNw|pf  
lysis buffer containing 150 mM and 200 mM NaCl, bound proteins were eluted with GST V$_.&S?(Y  
lysis buffer containing 400 mM NaCl and SDS sample buffer, sequentially. Eluted k]9y+WC2  
proteins were detected by SDS-PAGE and Coomassie blue staining. Protein bands were Y 8-;eqH  
identified with a Bruker Biflex III MALDI-TOF mass spectrometer (SpectroREADER; ,*sKr)9)  
Sequenom) and Protein Mass Fingerprinting Mascot search (Matrix Science). ' ,1[rWyc  
Subcellular fractionation. OD~yIV  
Cells were lysed by brief sonication on ice in a buffer of 250 mM sucrose, 20 mM Tris, oT!i}TW?o  
pH 7.8, 10 mM MgCl2, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF and Complete GF36G?iEi  
Protease Inhibitors. Lysates were centrifuged to remove nuclei and debris (900g for 5 min DFb hy  
at 4 °C). The P100 and S100 fractions were separated by centrifugation for 30 min at A>f rf[fAW  
100,000g. Membrane fractions were made soluble with MLB (Upstate) plus protease and @zJiR{Je-U  
phosphatase inhibitors. After centrifugation for additional 30 min at 100,000g, the qN^]`M[ BY  
detergent-insoluble cytoskeleton-containing fraction was resolved by 0.5% SDS-PAGE. mMT\"bb'  
Assessment of Intracellular Calcium Concentration tqpSir  
评价一下你浏览此帖子的感受

精彩

感动

搞笑

开心

愤怒

无聊

灌水

  
描述
快速回复

验证问题:
5+2=? 正确答案:7
按"Ctrl+Enter"直接提交